Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

5728

Name

PTEN

Synonymous

10q23del|BZS|DEC|GLM2|MHAM|MMAC1|PTEN1|TEP1;phosphatase and tensin homolog;PTEN;phosphatase and tensin homolog

Definition

MMAC1 phosphatase and tensin homolog deleted on chromosome 10|mutated in multiple advanced cancers 1|phosphatase and tensin-like protein|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN

Position

10q23.3

Gene Type

protein-coding

Gene Mutation:

PCGP data
COSMIC data

PCGP data   [Top]

Variant (Variant; Chr; Position)

Genotype (MutationType; MutationClass; ReferenceAllele; Genotype; Origin)

Disease (CancerType; ValidationStatus; SequencingType)

PTEN_P246R; chr10; 89717712

SUB; MISSENSE; C; G/G; SOMATICT-ALL; VALID;

PTEN_P246fs; chr10; 89717711

IFRAMESHIFT; -; -/CGGC; SOMATICT-ALL; VALID;

PTEN_R233fs; chr10; 89717674

IFRAMESHIFT; -; -/AT; SOMATICT-ALL; VALID;

PTEN_SRSLinsL247; chr10; 89717714

IPROTEINI-; -/AGCCGATCCTTA; SOMATICT-ALL; VALID;

PTEN_K221_D236fs; chr10; 89717636

DEL; FRAMESHIFT; AAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGA; AAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGA/-; SOMATICT-ALL; VALID;

PTEN_P246fs; chr10; 89717711

IFRAMESHIFT; -; -/CGGC; SOMATICT-ALL; VALID;

PTEN_R234fs; chr10; 89717675

IFRAMESHIFT; -; AAGCAAC/AAGCAAC; SOMATICT-ALL; VALID;

PTEN_R234fs; chr10; 89717675

IFRAMESHIFT; -; -/AAGCAAC; SOMATICT-ALL; VALID;

PTEN_R47K; chr10; 89653842

SUB; MISSENSE; G; G/A; SOMATICT-ALL; VALID;

PTEN_P246fs; chr10; 89717712

IFRAMESHIFT; -; -/GGGAGATG; SOMATICT-ALL; VALID;

PTEN_P246fs; chr10; 89717713

IFRAMESHIFT; -; -/C; SOMATICT-ALL; VALID;

PTEN_R130fs; chr10; 89692904

IFRAMESHIFT; -; -/A; SOMATICT-ALL; VALID;

PTEN_E242fs; chr10; 89717699

IFRAMESHIFT; -; -/TT; SOMATICT-ALL; VALID;

PTEN_R233fs; chr10; 89717672

IFRAMESHIFT; -; -/A; SOMATICT-ALL; VALID;

COSMIC data   [Top]

Mutation (CDS; AA; Chr)

Site

Histology

c.209+1delg; p.?;

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.1034T>A; p.L345Q; 10:89715031-89715031

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.200T>A; p.I67K; 10:89675285-89675285

livercarcinoma; hepatocellular_carcinoma

c.79T>A; p.Y27N; 10:89614285-89614285

large_intestinecarcinoma; adenocarcinoma

c.738delG; p.P246fs*10; 10:89707693-89707693

pancreascarcinoid-endocrine_tumour; islet_cell

c.388C>G; p.R130G; 10:89682884-89682884

lungcarcinoma; adenocarcinoma

c.967_968insA; p.N323fs*2;

ovarycarcinoma; endometrioid_carcinoma

c.?; p.R130*;

ovarycarcinoma; endometrioid_carcinoma

c.166delT; p.L57fs*42;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R233*;

endometriumcarcinoma; endometrioid_carcinoma

c.404_405insT; p.I135fs*45; 10:89682900-89682901

ovarycarcinoma; endometrioid_carcinoma

c.404_405insT; p.I135fs*45; 10:89682900-89682901

endometriumcarcinoma; endometrioid_carcinoma

c.741_742insA; p.P248fs*5; 10:89707696-89707697

ovarycarcinoma; endometrioid_carcinoma

c.741_742insA; p.P248fs*5; 10:89707696-89707697

endometriumcarcinoma; endometrioid_carcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

ovarycarcinoma; endometrioid_carcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R233*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R233*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.E7*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.E7*;

endometriumcarcinoma; endometrioid_carcinoma

c.19_20delGA; p.E7fs*3;

endometriumcarcinoma; endometrioid_carcinoma

c.170T>C; p.L57S; 10:89675255-89675255

central_nervous_system; brainglioma

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.511C>T; p.Q171*; 10:89701873-89701873

central_nervous_system; brainglioma; ependymoma_Grade_III-IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>C; p.C105S; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.371G>C; p.C124S; 10:89682867-89682867

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.165-1G>A; p.?; 10:89675249-89675249

breastcarcinoma; ER-PR-positive_carcinoma

c.494G>A; p.G165E; 10:89701856-89701856

pancreascarcinoid-endocrine_tumour

c.888T>A; p.C296*;

endometriumhyperplasia; complex-atypical

c.689G>A; p.G230E;

endometriumhyperplasia; complex-atypical

c.388C>G; p.R130G; 10:89682884-89682884

ovarylow_malignant_potential_(borderline)_tumour; endometrioid

c.481A>G; p.R161G;

thyroidcarcinoma; follicular_carcinoma

c.496G>A; p.V166I; 10:89701858-89701858

thyroidcarcinoma; follicular_carcinoma

c.728T>C; p.F243S;

thyroidcarcinoma; follicular_carcinoma

c.353A>G; p.H118R;

thyroidcarcinoma; follicular_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

thyroidcarcinoma; follicular_carcinoma

c.476G>A; p.R159K; 10:89682972-89682972

thyroidcarcinoma; follicular_carcinoma

c.701G>A; p.R234Q; 10:89707656-89707656

thyroidcarcinoma; follicular_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

thyroidcarcinoma; follicular_carcinoma

c.425G>A; p.R142Q; 10:89682921-89682921

thyroidcarcinoma; papillary_carcinoma

c.385G>A; p.G129R; 10:89682881-89682881

thyroidcarcinoma; papillary_carcinoma

c.452C>A; p.A151D; 10:89682948-89682948

thyroidcarcinoma; anaplastic_carcinoma

c.952C>T; p.L318F; 10:89710781-89710781

thyroidcarcinoma; anaplastic_carcinoma

c.1015C>T; p.P339S; 10:89710844-89710844

thyroidcarcinoma; anaplastic_carcinoma

c.485A>G; p.D162G; 10:89682981-89682981

thyroidcarcinoma; anaplastic_carcinoma

c.461T>C; p.F154S; 10:89682957-89682957

thyroidcarcinoma; anaplastic_carcinoma

c.464A>G; p.Y155C; 10:89682960-89682960

thyroidcarcinoma; anaplastic_carcinoma

c.443C>A; p.A148E; 10:89682939-89682939

thyroidcarcinoma; anaplastic_carcinoma

c.440A>G; p.K147R; 10:89682936-89682936

thyroidcarcinoma; anaplastic_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

thyroidcarcinoma; anaplastic_carcinoma

c.347A>G; p.D116G; 10:89682843-89682843

thyroidcarcinoma; anaplastic_carcinoma

c.17_18delAA; p.K6fs*4; 10:89614223-89614224

endometriumcarcinoma; endometrioid_carcinoma

c.187_188delAA; p.N63fs*10; 10:89675272-89675273

endometriumcarcinoma; endometrioid_carcinoma

c.167T>G; p.F56C;

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.313T>C; p.C105R; 10:89682809-89682809

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.491delA; p.K164fs*3; 10:89682987-89682987

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.962_963insA; p.N323fs*2; 10:89710791-89710792

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.862G>T; p.E288*; 10:89710691-89710691

endometriumcarcinoma; endometrioid_carcinoma

c.721_722delTT; p.F241fs*1; 10:89707676-89707677

endometriumcarcinoma; endometrioid_carcinoma

c.955_956insA; p.T319fs*6; 10:89710784-89710785

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.83delT; p.Y29fs*25; 10:89643765-89643765

endometriumcarcinoma; endometrioid_carcinoma

c.219_222delAAGA; p.E73fs*25; 10:89680792-89680795

endometriumcarcinoma; endometrioid_carcinoma

c.187_188delAA; p.N63fs*10; 10:89675272-89675273

endometriumcarcinoma; endometrioid_carcinoma

c.464A>G; p.Y155C; 10:89682960-89682960

endometriumcarcinoma; endometrioid_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.895G>T; p.E299*; 10:89710724-89710724

endometriumcarcinoma; endometrioid_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.334C>G; p.L112V; 10:89682830-89682830

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

endometriumcarcinoma; endometrioid_carcinoma

c.1-9C>T; p.?; 10:89614198-89614198

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.165-2delA; p.?; 10:89675248-89675248

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.182A>G; p.H61R; 10:89675267-89675267

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.315T>G; p.C105W; 10:89682811-89682811

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.315T>G; p.C105W; 10:89682811-89682811

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.315T>G; p.C105W; 10:89682811-89682811

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.385G>A; p.G129R; 10:89682881-89682881

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.638delC; p.P213fs*4; 10:89707593-89707593

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.743C>G; p.P248?; 10:89707698-89707698

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.743C>G; p.P248?; 10:89707698-89707698

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.743C>G; p.P248?; 10:89707698-89707698

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.743C>G; p.P248?; 10:89707698-89707698

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1091C>G; p.S364C; 10:89715088-89715088

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1091C>G; p.S364C; 10:89715088-89715088

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1133_1136delGATA; p.R378fs*25; 10:89715130-89715133

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.370T>A; p.C124S; 10:89682866-89682866

thyroidcarcinoma; follicular_carcinoma

c.425G>A; p.R142Q; 10:89682921-89682921

thyroidcarcinoma; follicular_carcinoma

c.253+?ins?; p.?;

livercarcinoma; hepatocellular_carcinoma

c.253+?ins?; p.?;

livercarcinoma; hepatocellular_carcinoma

c.253+?ins?; p.?;

livercarcinoma; hepatocellular_carcinoma

c.253+?delC; p.?;

livercarcinoma; hepatocellular_carcinoma

c.253+?T>A; p.?;

livercarcinoma; hepatocellular_carcinoma

c.815A>C; p.H272P;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; Burkitt_lymphoma

c.253+42C>T; p.?; 10:89680868-89680868

haematopoietic_and_lymphoid_tissuehaematopoietic_neoplasm; acute_myeloid_leukaemia_associated_with_MDS

c.?; p.Q17*;

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; diffuse_large_B_cell_lymphoma

c.702_703ins20; p.R234fs*26;

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; peripheral_T_cell_lymphoma_unspecified

c.332G>A; p.W111*; 10:89682828-89682828

breastcarcinoma; basal_(triple-negative)_carcinoma

c.1148C>T; p.T383I;

soft_tissue; fibrous_tissue_and_uncertain_omalignant_melanoma_of_soft_parts-clear_cell_sarcoma

c.5C>T; p.T2I;

soft_tissue; fibrous_tissue_and_uncertain_omalignant_melanoma_of_soft_parts-clear_cell_sarcoma

c.254-3C>T; p.?; 10:89682747-89682747

breastcarcinoma; adenoid_cystic_carcinoma

c.254-3C>T; p.?; 10:89682747-89682747

breastcarcinoma; adenoid_cystic_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.G132D;

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.645delT; p.F215fs*6; 10:89707600-89707600

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130G;

endometriumcarcinoma; endometrioid_carcinoma

c.723_724insT; p.E242fs*1; 10:89707678-89707679

endometriumcarcinoma; endometrioid_carcinoma

c.519_520delCT; p.Y174fs*5; 10:89701881-89701882

endometriumcarcinoma; endometrioid_carcinoma

c.800_801insA; p.K267fs*31; 10:89707755-89707756

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130Q;

endometriumcarcinoma; endometrioid_carcinoma

c.437_438insT; p.L146fs*34; 10:89682933-89682934

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.F81L;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.E7*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R15I;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.K128N;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.S59*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.L70F;

endometriumcarcinoma; endometrioid_carcinoma

c.433_438delTTTTTA; p.F145_L146del; 10:89682929-89682934

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.L146*;

endometriumcarcinoma; endometrioid_carcinoma

c.469_470insG; p.E157fs*23; 10:89682965-89682966

endometriumcarcinoma; endometrioid_carcinoma

c.993delC; p.D331fs*13; 10:89710822-89710822

endometriumcarcinoma; endometrioid_carcinoma

c.391delA; p.T131fs*3; 10:89682887-89682887

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R173C;

endometriumcarcinoma; endometrioid_carcinoma

c.43A>G; p.R15G;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; Burkitt_lymphoma

c.650T>A; p.V217D;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; Burkitt_lymphoma

c.40A>G; p.R14G; 10:89614246-89614246

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; Burkitt_lymphoma

c.217G>T; p.E73*; 10:89680790-89680790

endometriumcarcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.253+1G>A; p.?; 10:89680827-89680827

endometriumcarcinoma; endometrioid_carcinoma

c.210-7delCTTTT; p.?; 10:89680776-89680780

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.344delA; p.D115fs*19; 10:89682840-89682840

endometriumcarcinoma; endometrioid_carcinoma

c.469_470insG; p.E157fs*23; 10:89682965-89682966

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.405_406insA; p.I135fs*44; 10:89682901-89682902

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.195C>A; p.Y65*; 10:89675280-89675280

endometriumcarcinoma; endometrioid_carcinoma

c.932_933insA; p.N311fs*2; 10:89710761-89710762

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.783_784delGA; p.N262fs*35; 10:89707738-89707739

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.723_724insT; p.E242fs*1; 10:89707678-89707679

endometriumcarcinoma; endometrioid_carcinoma

c.801_802insA; p.D268fs*30;

endometriumcarcinoma; endometrioid_carcinoma

c.170_171insT; p.L57fs*6; 10:89675255-89675256

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.414T>A; p.Y138*;

lungcarcinoma; squamous_cell_carcinoma

c.1_1212del1212; p.0?;

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.760_761AA>TCC; p.K254fs*44; 10:89707715-89707716

stomachcarcinoma; adenocarcinoma

c.635-91G>C; p.?; 10:89707499-89707499

stomachcarcinoma; adenocarcinoma

c.254-24T>G; p.?; 10:89682726-89682726

stomachcarcinoma; adenocarcinoma

c.254-7delA; p.?; 10:89682743-89682743

stomachcarcinoma; adenocarcinoma

c.213delT; p.C71fs*28; 10:89680786-89680786

ovarycarcinoma; endometrioid_carcinoma

c.19G>T; p.E7*; 10:89614225-89614225

ovarycarcinoma; endometrioid_carcinoma

c.262T>A; p.Y88N; 10:89682758-89682758

ovarycarcinoma; endometrioid_carcinoma

c.391A>C; p.T131P; 10:89682887-89682887

ovarycarcinoma; endometrioid_carcinoma

c.951_954delACTT; p.V317fs*3; 10:89710780-89710783

ovarycarcinoma; endometrioid_carcinoma

c.511C>T; p.Q171*; 10:89701873-89701873

ovarycarcinoma; endometrioid_carcinoma

c.395G>A; p.G132D; 10:89682891-89682891

ovarycarcinoma; endometrioid_carcinoma

c.209+5G>A; p.?; 10:89675299-89675299

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; occipital_lobeglioma; astrocytoma_Grade_IV

c.492+5insT; p.?; 10:89682993-89682994

livercarcinoma; hepatocellular_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma

c.923delG; p.R308fs*9; 10:89710752-89710752

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130*;

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.7_9GCC>TT; p.A3fs*21; 10:89614213-89614215

endometriumendometrial_intraepithelial_neoplasia

c.7_9GCC>TT; p.A3fs*21; 10:89614213-89614215

endometriumendometrial_intraepithelial_neoplasia

c.131_137delGCGTATA; p.G44fs*8; 10:89643813-89643819

endometriumcarcinoma; endometrioid_carcinoma

c.204C>G; p.Y68*; 10:89675289-89675289

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.166T>G; p.F56V; 10:89675251-89675251

endometriumcarcinoma; endometrioid_carcinoma

c.334C>G; p.L112V; 10:89682830-89682830

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.922_928delCGTGCAG; p.R308fs*7; 10:89710751-89710757

endometriumcarcinoma; endometrioid_carcinoma

c.321_326delTCTTGA; p.L108_D109del; 10:89682817-89682822

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.60delA; p.F21fs*3; 10:89614266-89614266

endometriumcarcinoma; endometrioid_carcinoma

c.198G>T; p.K66N; 10:89675283-89675283

endometriumcarcinoma; endometrioid_carcinoma

c.377C>A; p.A126D; 10:89682873-89682873

endometriumcarcinoma; endometrioid_carcinoma

c.733C>T; p.Q245*; 10:89707688-89707688

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.176C>A; p.S59*; 10:89675261-89675261

endometriumcarcinoma; endometrioid_carcinoma

c.9_10delCA; p.I4fs*6; 10:89614215-89614216

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.572delT; p.V191fs*8; 10:89701934-89701934

endometriumcarcinoma; endometrioid_carcinoma

c.209+5G>A; p.?; 10:89675299-89675299

endometriumcarcinoma; endometrioid_carcinoma

c.493G>A; p.G165R; 10:89701855-89701855

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.139A>G; p.R47G; 10:89643821-89643821

endometriumcarcinoma; endometrioid_carcinoma

c.493G>A; p.G165R; 10:89701855-89701855

endometriumcarcinoma; endometrioid_carcinoma

c.441_444delGGCA; p.K147fs*5; 10:89682937-89682940

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.511C>T; p.Q171*; 10:89701873-89701873

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.867delA; p.V290fs*1; 10:89710696-89710696

endometriumcarcinoma; endometrioid_carcinoma

c.376G>T; p.A126S; 10:89682872-89682872

endometriumcarcinoma; endometrioid_carcinoma

c.367C>T; p.H123Y; 10:89682863-89682863

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.46_47insT; p.Y16fs*28; 10:89614252-89614253

endometriumcarcinoma; endometrioid_carcinoma

c.751_752insTG; p.G251fs*6; 10:89707706-89707707

endometriumcarcinoma; endometrioid_carcinoma

c.493G>A; p.G165R; 10:89701855-89701855

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.39_65del27; p.R14_D22del; 10:89614245-89614271

endometriumcarcinoma; endometrioid_carcinoma

c.862_863delGA; p.E288fs*9; 10:89710691-89710692

endometriumcarcinoma; endometrioid_carcinoma

c.209+1delGTAA; p.?; 10:89675295-89675298

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.367C>T; p.H123Y; 10:89682863-89682863

endometriumcarcinoma; endometrioid_carcinoma

c.428delG; p.G143fs*4; 10:89682924-89682924

endometriumcarcinoma; endometrioid_carcinoma

c.384G>T; p.K128N; 10:89682880-89682880

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; endometrioid_carcinoma

c.959T>G; p.L320*; 10:89710788-89710788

endometriumcarcinoma; endometrioid_carcinoma

c.395G>A; p.G132D; 10:89682891-89682891

endometriumcarcinoma; endometrioid_carcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

endometriumcarcinoma; endometrioid_carcinoma

c.598_599delTT; p.F200fs*1; 10:89701960-89701961

endometriumcarcinoma; endometrioid_carcinoma

c.520T>G; p.Y174D; 10:89701882-89701882

endometriumcarcinoma; endometrioid_carcinoma

c.1027-2A>G; p.?; 10:89715022-89715022

endometriumcarcinoma; endometrioid_carcinoma

c.532delT; p.Y178fs*5; 10:89701894-89701894

endometriumcarcinoma; endometrioid_carcinoma

c.802-1G>A; p.?; 10:89710630-89710630

endometriumcarcinoma; endometrioid_carcinoma

c.635-1G>A; p.?; 10:89707589-89707589

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.898delA; p.I300fs*7; 10:89710727-89710727

endometriumcarcinoma; endometrioid_carcinoma

c.639_663>GGCAA; p.Q214fs*22; 10:89707594-89707618

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.1027-1G>A; p.?; 10:89715023-89715023

endometriumcarcinoma; endometrioid_carcinoma

c.967_968insA; p.N323fs*2;

endometriumcarcinoma; endometrioid_carcinoma

c.713_714insT; p.M239fs*4; 10:89707668-89707669

endometriumcarcinoma; endometrioid_carcinoma

c.950_954delTACTT; p.V317fs*6; 10:89710779-89710783

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.71A>G; p.D24G; 10:89614277-89614277

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.355delG; p.V119fs*15; 10:89682851-89682851

endometriumcarcinoma; endometrioid_carcinoma

c.824T>C; p.V275A; 10:89710653-89710653

endometriumcarcinoma; endometrioid_carcinoma

c.80A>G; p.Y27C; 10:89643762-89643762

endometriumcarcinoma; endometrioid_carcinoma

c.850G>T; p.E284*; 10:89710679-89710679

endometriumcarcinoma; endometrioid_carcinoma

c.871G>T; p.E291*; 10:89710700-89710700

endometriumcarcinoma; endometrioid_carcinoma

c.209+1delGT; p.?; 10:89675295-89675296

endometriumcarcinoma; endometrioid_carcinoma

c.209+5G>A; p.?; 10:89675299-89675299

endometriumcarcinoma; endometrioid_carcinoma

c.227_228delAT; p.Y76fs*1; 10:89680800-89680801

endometriumcarcinoma; endometrioid_carcinoma

c.227_228delAT; p.Y76fs*1; 10:89680800-89680801

endometriumcarcinoma; endometrioid_carcinoma

c.362_363delCA; p.A121fs*4; 10:89682858-89682859

endometriumcarcinoma; endometrioid_carcinoma

c.367C>T; p.H123Y; 10:89682863-89682863

endometriumcarcinoma; endometrioid_carcinoma

c.370T>A; p.C124S; 10:89682866-89682866

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.932delA; p.N311fs*6; 10:89710761-89710761

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>C; p.R130P; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.410_414delCATAT; p.A137fs*41; 10:89682906-89682910

endometriumcarcinoma; endometrioid_carcinoma

c.48_49delTC; p.Y16fs*1; 10:89614254-89614255

endometriumcarcinoma; endometrioid_carcinoma

c.520T>G; p.Y174D; 10:89701882-89701882

endometriumcarcinoma; endometrioid_carcinoma

c.534T>A; p.Y178*; 10:89701896-89701896

endometriumcarcinoma; endometrioid_carcinoma

c.593T>A; p.M198K; 10:89701955-89701955

endometriumcarcinoma; endometrioid_carcinoma

c.662delA; p.K221fs*2; 10:89707617-89707617

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.741_742insA; p.P248fs*5; 10:89707696-89707697

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.801+1G>T; p.?; 10:89707757-89707757

endometriumcarcinoma; endometrioid_carcinoma

c.802-2A>T; p.?; 10:89710629-89710629

endometriumcarcinoma; endometrioid_carcinoma

c.878delG; p.G293fs*14; 10:89710707-89710707

endometriumcarcinoma; endometrioid_carcinoma

c.883_884delCT; p.L295fs*2; 10:89710712-89710713

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.48T>A; p.Y16*; 10:89614254-89614254

endometriumcarcinoma; endometrioid_carcinoma

c.386G>A; p.G129E; 10:89682882-89682882

endometriumcarcinoma; endometrioid_carcinoma

c.68T>G; p.L23*; 10:89614274-89614274

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.A86A;

large_intestinecarcinoma; adenocarcinoma

c.?; p.V85A;

large_intestinecarcinoma; adenocarcinoma

c.307C>T; p.P103S; 10:89682803-89682803

large_intestinecarcinoma; adenocarcinoma

c.295G>T; p.E99*; 10:89682791-89682791

large_intestinecarcinoma; adenocarcinoma

c.?; p.F279F;

large_intestinecarcinoma; adenocarcinoma

c.?; p.V85A;

large_intestinecarcinoma; adenocarcinoma

c.?_?del?; p.A328fs;

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.476G>A; p.R159K; 10:89682972-89682972

central_nervous_system; lateral_ventricleglioma; ependymoma_Grade_II

c.476G>A; p.R159K; 10:89682972-89682972

central_nervous_system; occipital_lobeglioma; astrocytoma_Grade_II

c.1_1212del1212; p.0?;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.1_1212del1212; p.0?;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.700_701ins10; p.R234fs*4; 10:89707655-89707656

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.697C>T; p.R233*; 10:89707652-89707652

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.703_704ins11; p.E235fs*25; 10:89707658-89707659

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.689_690insG; p.P231fs*12; 10:89707644-89707645

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.700_701CG>AACCCCC; p.R234fs*24; 10:89707655-89707656

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.700_701ins14; p.R234fs*27; 10:89707655-89707656

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.700_701insCCCG; p.R234fs*10; 10:89707655-89707656

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.724_725GA>CCCT; p.E242fs*15; 10:89707679-89707680

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.737_738insACCATGTT; p.L247fs*12; 10:89707692-89707693

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.737_738ins13; p.L247fs*10; 10:89707692-89707693

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.737_738insTGACC; p.L247fs*11; 10:89707692-89707693

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.738_739insCACTCAC; p.L247fs*8; 10:89707693-89707694

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.274G>A; p.D92N; 10:89682770-89682770

breastcarcinoma

c.315T>G; p.C105W; 10:89682811-89682811

breastcarcinoma

c.319G>A; p.D107N; 10:89682815-89682815

breastcarcinoma

c.361G>C; p.A121P; 10:89682857-89682857

breastcarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

breastcarcinoma

c.462C>T; p.F154F; 10:89682958-89682958

skincarcinoma; squamous_cell_carcinoma

c.457_458insT; p.D153fs*27; 10:89682953-89682954

skincarcinoma; squamous_cell_carcinoma

c.758T>A; p.I253N; 10:89707713-89707713

skinmalignant_melanoma

c.637C>T; p.P213S; 10:89707592-89707592

skinmalignant_melanoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

prostatecarcinoma; adenocarcinoma

c.132C>T; p.G44G; 10:89643814-89643814

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>T; p.C105F; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.132C>T; p.G44G; 10:89643814-89643814

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>T; p.C105F; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.530A>G; p.Y177C; 10:89701892-89701892

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.530A>G; p.Y177C; 10:89701892-89701892

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>T; p.C105F; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>T; p.C105F; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.263A>G; p.Y88C; 10:89682759-89682759

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.263A>G; p.Y88C; 10:89682759-89682759

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1027-2A>G; p.?; 10:89715022-89715022

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.223C>A; p.H75N; 10:89680796-89680796

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1027-2A>G; p.?; 10:89715022-89715022

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.530A>G; p.Y177C; 10:89701892-89701892

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.530A>G; p.Y177C; 10:89701892-89701892

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.755A>G; p.D252G; 10:89707710-89707710

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.701_729del29; p.R234fs*9; 10:89707656-89707684

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.696_705del10; p.R233fs*20; 10:89707651-89707660

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.737_738insCC; p.L247fs*10; 10:89707692-89707693

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.721_722TT>CTTGGCC; p.F241fs*17; 10:89707676-89707677

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.696_697insA; p.R233fs*10; 10:89707651-89707652

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.737_738insGGGCCC; p.P246_L247insGP; 10:89707692-89707693

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.698_699GA>CCT; p.R233fs*10; 10:89707653-89707654

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.700_701insAA; p.R234fs*23; 10:89707655-89707656

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.697_700CGAC>TGCAGTGGTCA; p.R233fs*12; 10:89707652-89707655

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.755_787>CGAAAG; p.D252_K263>AKE; 10:89707710-89707742

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.2_13>14; p.M1fs*24; 10:89614208-89614219

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.696_697insA; p.R233fs*10; 10:89707651-89707652

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.699_700ins11; p.R234fs*26; 10:89707654-89707655

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; clear_cell_carcinoma

c.812T>C; p.F271S; 10:89710641-89710641

skin; armmalignant_melanoma

c.712T>C; p.F238L; 10:89707667-89707667

central_nervous_system; occipital_lobeglioma

c.1192A>T; p.T398S; 10:89715189-89715189

central_nervous_system; occipital_lobeglioma

c.22_42ATCGTTAGCAGAAACAAAAGG>21; p.I8_R14>LRLICIF; 10:89614228-89614248

central_nervous_system; occipital_lobeglioma

c.493G>T; p.G165*; 10:89701855-89701855

lungcarcinoma; squamous_cell_carcinoma

c.944_945insCT; p.L316fs*2; 10:89710773-89710774

lungcarcinoma; squamous_cell_carcinoma

c.375A>T; p.K125N; 10:89682871-89682871

lungcarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

lungcarcinoma; squamous_cell_carcinoma

c.540C>G; p.Y180*; 10:89701902-89701902

lungcarcinoma; squamous_cell_carcinoma

c.686C>G; p.S229*; 10:89707641-89707641

lungcarcinoma; squamous_cell_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

lungcarcinoma; squamous_cell_carcinoma

c.463T>C; p.Y155H; 10:89682959-89682959

lungcarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R233*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130G;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130G;

endometriumcarcinoma; endometrioid_carcinoma

c.(871_873)insA; p.(E291)fs;

endometriumcarcinoma; endometrioid_carcinoma

c.(694_696)insA; p.(T232)fs;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.K164R;

endometriumcarcinoma; endometrioid_carcinoma

c.(37_39)insC; p.(K13)fs;

endometriumcarcinoma; endometrioid_carcinoma

c.803delA; p.D268fs*8; 10:89710632-89710632

endometriumcarcinoma; endometrioid_carcinoma

c.491delA; p.K164fs*3; 10:89682987-89682987

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.L25F;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R173C;

endometriumcarcinoma; endometrioid_carcinoma

c.820delT; p.W274fs*2; 10:89710649-89710649

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R173C;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.P213H;

endometriumcarcinoma; endometrioid_carcinoma

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.L146*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.G132R;

endometriumcarcinoma; endometrioid_carcinoma

c.(298_300)insA; p.(L100)fs;

endometriumcarcinoma; endometrioid_carcinoma

c.(871_879)del7; p.(E291)fs;

endometriumcarcinoma; endometrioid_carcinoma

c.411delA; p.Y138fs*9; 10:89682907-89682907

endometriumcarcinoma; endometrioid_carcinoma

c.425G>A; p.R142Q; 10:89682921-89682921

thyroidcarcinoma; papillary_carcinoma

c.179_179delA; p.K60fs*39; 10:89675264-89675264

breastcarcinoma

c.179_179delA; p.K60fs*39; 10:89675264-89675264

breastcarcinoma

c.179_179delA; p.K60fs*39; 10:89675264-89675264

breasthyperplasia; atypical_ductal_hyperplasia

c.179_179delA; p.K60fs*39; 10:89675264-89675264

breastcarcinoma

c.478A>T; p.T160S; 10:89682974-89682974

breastcarcinoma

c.165G>T; p.R55S; 10:89675250-89675250

breastcarcinoma

c.216T>C; p.A72A; 10:89680789-89680789

breastcarcinoma

c.221_221delG; p.R74fs*25; 10:89680794-89680794

breastcarcinoma; ductal_carcinoma

c.377C>A; p.A126D; 10:89682873-89682873

breastcarcinoma

c.377C>A; p.A126D; 10:89682873-89682873

breasthyperplasia; atypical_ductal_hyperplasia

c.389G>A; p.R130Q; 10:89682885-89682885

breastcarcinoma

c.482G>T; p.R161I; 10:89682978-89682978

breastcarcinoma

c.482G>T; p.R161I; 10:89682978-89682978

breasthyperplasia; atypical_ductal_hyperplasia

c.482G>A; p.R161K; 10:89682978-89682978

breastcarcinoma

c.482G>A; p.R161K; 10:89682978-89682978

breasthyperplasia; atypical_ductal_hyperplasia

c.766G>A; p.E256K; 10:89707721-89707721

breastcarcinoma; ductal_carcinoma

c.491delA; p.K164fs*3; 10:89682987-89682987

prostatecarcinoma; adenocarcinoma

c.?; p.P95S;

prostatecarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma

c.?_?ins?; p.Y174fs;

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.878delG; p.G293fs*14; 10:89710707-89710707

large_intestine; coloncarcinoma; adenocarcinoma

c.19G>T; p.E7*; 10:89614225-89614225

large_intestine; rectumcarcinoma; adenocarcinoma

c.895G>T; p.E299*; 10:89710724-89710724

large_intestine; rectumcarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

large_intestine; rectumcarcinoma; adenocarcinoma

c.254T>G; p.V85G; 10:89682750-89682750

large_intestine; rectumcarcinoma; adenocarcinoma

c.820T>C; p.W274R; 10:89710649-89710649

large_intestine; rectumcarcinoma; adenocarcinoma

c.45A>T; p.R15S; 10:89614251-89614251

large_intestine; coloncarcinoma; adenocarcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

large_intestine; coloncarcinoma; adenocarcinoma

c.70G>A; p.D24N; 10:89614276-89614276

large_intestine; coloncarcinoma; adenocarcinoma

c.2T>C; p.M1T; 10:89614208-89614208

large_intestine; coloncarcinoma; adenocarcinoma

c.871G>T; p.E291*; 10:89710700-89710700

large_intestine; coloncarcinoma; adenocarcinoma

c.302T>C; p.I101T; 10:89682798-89682798

large_intestine; rectumcarcinoma; adenocarcinoma

c.196A>G; p.K66E; 10:89675281-89675281

large_intestine; coloncarcinoma; adenocarcinoma

c.514A>T; p.R172W; 10:89701876-89701876

large_intestine; coloncarcinoma; adenocarcinoma

c.863delA; p.E288fs*3; 10:89710692-89710692

large_intestine; coloncarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestine; coloncarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestine; coloncarcinoma; adenocarcinoma

c.750_751delTG; p.C250fs*2; 10:89707705-89707706

large_intestine; coloncarcinoma; adenocarcinoma

c.964_964delA; p.N323fs*21; 10:89710793-89710793

large_intestine; coloncarcinoma; adenocarcinoma

c.?; p.T202I;

biliary_tract; gallbladdercarcinoma; adenocarcinoma

c.?; p.E235G;

biliary_tract; gallbladdercarcinoma; adenocarcinoma

c.?; p.F271L;

biliary_tract; bile_ductcarcinoma; adenocarcinoma

c.491_492insA; p.K164fs*16; 10:89682987-89682988

endometriumcarcinoma; endometrioid_carcinoma

c.19G>T; p.E7*; 10:89614225-89614225

endometriumcarcinoma; endometrioid_carcinoma

c.923delG; p.R308fs*9; 10:89710752-89710752

endometriumcarcinoma; endometrioid_carcinoma

c.328C>T; p.Q110*; 10:89682824-89682824

endometriumcarcinoma; endometrioid_carcinoma

c.878_879delGA; p.G293fs*4; 10:89710707-89710708

endometriumcarcinoma; endometrioid_carcinoma

c.922_922delC; p.R308fs*9; 10:89710751-89710751

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.18A>C; p.K6N; 10:89614224-89614224

endometriumcarcinoma; endometrioid_carcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

endometriumcarcinoma; endometrioid_carcinoma

c.275A>T; p.D92V; 10:89682771-89682771

endometriumcarcinoma; endometrioid_carcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

endometriumcarcinoma; endometrioid_carcinoma

c.794_795insA; p.D268fs*30; 10:89707749-89707750

endometriumcarcinoma; endometrioid_carcinoma

c.376G>C; p.A126P; 10:89682872-89682872

endometriumcarcinoma; endometrioid_carcinoma

c.101C>A; p.A34D; 10:89643783-89643783

endometriumcarcinoma; endometrioid_carcinoma

c.863delA; p.E288fs*3; 10:89710692-89710692

endometriumcarcinoma; endometrioid_carcinoma

c.184delA; p.N63fs*36; 10:89675269-89675269

endometriumcarcinoma; endometrioid_carcinoma

c.733C>T; p.Q245*; 10:89707688-89707688

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.71A>G; p.D24G; 10:89614277-89614277

endometriumcarcinoma; endometrioid_carcinoma

c.141_141delG; p.N48fs*6; 10:89643823-89643823

endometriumcarcinoma; endometrioid_carcinoma

c.545T>G; p.L182*; 10:89701907-89701907

endometriumcarcinoma; endometrioid_carcinoma

c.954_958delTACTT; p.T319fs*4; 10:89710783-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.955_996del42; p.T319_K332del; 10:89710784-89710825

endometriumcarcinoma; endometrioid_carcinoma

c.606_606delT; p.I203fs*18; 10:89701968-89701968

endometriumcarcinoma; endometrioid_carcinoma

c.825_825delA; p.N276fs*15; 10:89710654-89710654

endometriumcarcinoma; endometrioid_carcinoma

c.758_760TCA>CC; p.I253fs*3; 10:89707713-89707715

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.960_961insA; p.T321fs*4; 10:89710789-89710790

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.962_963insA; p.N323fs*2; 10:89710791-89710792

endometriumcarcinoma; endometrioid_carcinoma

c.974T>C; p.L325P; 10:89710803-89710803

endometriumcarcinoma; endometrioid_carcinoma

c.49C>T; p.Q17*; 10:89614255-89614255

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.283C>T; p.P95S; 10:89682779-89682779

endometriumcarcinoma; endometrioid_carcinoma

c.365T>A; p.I122N; 10:89682861-89682861

endometriumcarcinoma; endometrioid_carcinoma

c.1027-1G>A; p.?; 10:89715023-89715023

endometriumcarcinoma; endometrioid_carcinoma

c.267_267delT; p.F90fs*9; 10:89682763-89682763

endometriumcarcinoma; endometrioid_carcinoma

c.165-1G>C; p.?; 10:89675249-89675249

endometriumcarcinoma; endometrioid_carcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.62T>C; p.F21S; 10:89614268-89614268

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.560_561insT; p.Y188fs*2; 10:89701922-89701923

endometriumcarcinoma; endometrioid_carcinoma

c.860C>G; p.S287*; 10:89710689-89710689

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.226_227delTA; p.Y76fs*1; 10:89680799-89680800

endometriumcarcinoma; endometrioid_carcinoma

c.800_801insA; p.K267fs*31; 10:89707755-89707756

endometriumcarcinoma; endometrioid_carcinoma

c.267_267delT; p.F90fs*9; 10:89682763-89682763

endometriumcarcinoma; endometrioid_carcinoma

c.420A>T; p.L140F; 10:89682916-89682916

endometriumcarcinoma; endometrioid_carcinoma

c.1212A>T; p.*404CIFFYQEG*; 10:89715209-89715209

endometriumcarcinoma; endometrioid_carcinoma

c.165_166insT; p.L57fs*6; 10:89675250-89675251

endometriumcarcinoma; endometrioid_carcinoma

c.863delA; p.E288fs*3; 10:89710692-89710692

endometriumcarcinoma; endometrioid_carcinoma

c.37A>T; p.K13*; 10:89614243-89614243

endometriumcarcinoma; endometrioid_carcinoma

c.787A>T; p.K263*; 10:89707742-89707742

endometriumcarcinoma; endometrioid_carcinoma

c.583_583delT; p.H196fs*3; 10:89701945-89701945

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.518G>A; p.R173H; 10:89701880-89701880

endometriumcarcinoma; serous_carcinoma

c.198G>T; p.K66N; 10:89675283-89675283

endometriumcarcinoma; serous_carcinoma

c.1009delT; p.F337fs*7; 10:89710838-89710838

endometriumcarcinoma; serous_carcinoma

c.376G>A; p.A126T; 10:89682872-89682872

endometriumcarcinoma; serous_carcinoma

c.274G>T; p.D92Y; 10:89682770-89682770

endometriumcarcinoma; serous_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; serous_carcinoma

c.186A>C; p.K62N; 10:89675271-89675271

endometriumcarcinoma; serous_carcinoma

c.373A>G; p.K125E; 10:89682869-89682869

endometriumcarcinoma; clear_cell_carcinoma

c.661A>T; p.K221*; 10:89707616-89707616

endometriumcarcinoma; clear_cell_carcinoma

c.67T>G; p.L23V; 10:89614273-89614273

endometriumcarcinoma; serous_carcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

endometriumcarcinoma; endometrioid_carcinoma

c.1015C>T; p.P339S; 10:89710844-89710844

large_intestinecarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestinecarcinoma; adenocarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

large_intestinecarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestinecarcinoma; adenocarcinoma

c.946_968del23; p.L316fs*1; 10:89710775-89710797

large_intestinecarcinoma; adenocarcinoma

c.818T>C; p.F273S; 10:89710647-89710647

breastcarcinoma; basal_(triple-negative)_carcinoma

c.970_971insG; p.D324fs*3; 10:89710799-89710800

breastcarcinoma; ER-PR-positive_carcinoma

c.739_740insT; p.L247fs*6; 10:89707694-89707695

breastcarcinoma; ER-PR-positive_carcinoma

c.953_956delTTAC; p.L318fs*2; 10:89710782-89710785

breastcarcinoma; ER-PR-positive_carcinoma

c.273_273delA; p.D92fs*7; 10:89682769-89682769

cervixcarcinoma; squamous_cell_carcinoma

c.1067_1067delA; p.N356fs*10; 10:89715064-89715064

cervixcarcinoma; squamous_cell_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.904_919del16; p.I303fs*9; 10:89710733-89710748

large_intestinecarcinoma; adenocarcinoma

c.?; p.Y88C;

large_intestinecarcinoma; adenocarcinoma

c.?; p.L325H;

large_intestinecarcinoma; adenocarcinoma

c.?; p.F341V;

large_intestinecarcinoma; adenocarcinoma

c.?; p.R74I;

large_intestinecarcinoma; adenocarcinoma

c.?; p.A86P;

large_intestinecarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

soft_tissue; fibrous_tissue_and_uncertain_omalignant_fibrous_histiocytoma-pleomorphic_sarcoma

c.1000A>T; p.N334Y; 10:89710829-89710829

soft_tissue; fibrous_tissue_and_uncertain_oalveolar_soft_part_sarcoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma

c.29G>A; p.S10N; 10:89614235-89614235

lungcarcinoma; adenocarcinoma

c.?; p.R130?;

ovarycarcinoma; endometrioid_carcinoma

c.210-22_229del42; p.?; 10:89680761-89680802

breastcarcinoma

c.210_634del425; p.?; 10:89680783-89701996

breastcarcinoma

c.389G>T; p.R130L; 10:89682885-89682885

breastcarcinoma

c.?; p.E91G;

haematopoietic_and_lymphoid_tissuehaematopoietic_neoplasm; acute_leukaemic_transformation_of_essential_thrombocythaemia

c.?; p.T232fs*24;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R130G;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.F145fs*37;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233fs*23;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.P246fs*11;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.D236fs*9;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.P246fs*12;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233fs*13;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.Q245fs*8;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R130fs*4;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.P246fs*3;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233*;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R234fs*10;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.P246fs*9;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233fs*10;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.P244fs*18;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.C250fs*10;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233fs*10;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.P246fs*14;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.L181fs*2;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.I306fs*7;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.T232fs*14;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.T277A;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.C105fs*2;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.K237fs*5;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.P246fs*3;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.1_1212del1212; p.0?; 10:89614207-89715209

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.1_1212del1212; p.0?; 10:89614207-89715209

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1_1212del1212; p.0?; 10:89614207-89715209

central_nervous_system; frontal_lobeglioma; astrocytoma_Grade_IV

c.1_1212del1212; p.0?; 10:89614207-89715209

central_nervous_system; frontal_lobeglioma; astrocytoma_Grade_IV

c.737C>T; p.P246L; 10:89707692-89707692

lungcarcinoma; adenocarcinoma

c.462C>A; p.F154L; 10:89682958-89682958

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.802-18_815del32; p.?; 10:89710613-89710644

endometriumcarcinoma; endometrioid_carcinoma

c.394G>A; p.G132S; 10:89682890-89682890

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.70G>T; p.D24Y; 10:89614276-89614276

endometriumcarcinoma; endometrioid_carcinoma

c.510_515delTCAGAG; p.S170_Q171del; 10:89701872-89701877

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.210-13A>G; p.?; 10:89680770-89680770

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.415T>G; p.L139V; 10:89682911-89682911

endometriumcarcinoma; endometrioid_carcinoma

c.377C>T; p.A126V; 10:89682873-89682873

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.531_533delTTA; p.Y178del; 10:89701893-89701895

endometriumcarcinoma; endometrioid_carcinoma

c.203A>G; p.Y68C; 10:89675288-89675288

endometriumcarcinoma; endometrioid_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; endometrioid_carcinoma

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.477G>T; p.R159S; 10:89682973-89682973

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.19G>T; p.E7*; 10:89614225-89614225

endometriumcarcinoma; endometrioid_carcinoma

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

endometriumcarcinoma; endometrioid_carcinoma

c.226_228delTAT; p.Y76del; 10:89680799-89680801

endometriumcarcinoma; endometrioid_carcinoma

c.469_470insG; p.E157fs*23; 10:89682965-89682966

endometriumcarcinoma; endometrioid_carcinoma

c.741_742insA; p.P248fs*5; 10:89707696-89707697

endometriumcarcinoma; endometrioid_carcinoma

c.640C>T; p.Q214*; 10:89707595-89707595

endometriumcarcinoma; endometrioid_carcinoma

c.133_133delG; p.V45fs*9; 10:89643815-89643815

endometriumcarcinoma; endometrioid_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; endometrioid_carcinoma

c.741_742insA; p.P248fs*5; 10:89707696-89707697

endometriumcarcinoma; endometrioid_carcinoma

c.406T>C; p.C136R; 10:89682902-89682902

endometriumcarcinoma; endometrioid_carcinoma

c.44_60del17; p.R15fs*23; 10:89614250-89614266

endometriumcarcinoma; endometrioid_carcinoma

c.202T>A; p.Y68N; 10:89675287-89675287

endometriumcarcinoma; endometrioid_carcinoma

c.113C>G; p.P38R; 10:89643795-89643795

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.1026+1G>T; p.?; 10:89710856-89710856

endometriumcarcinoma; endometrioid_carcinoma

c.46_47insT; p.Y16fs*28; 10:89614252-89614253

endometriumcarcinoma; endometrioid_carcinoma

c.379G>A; p.G127R; 10:89682875-89682875

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.T321fs*23;

endometriumcarcinoma; endometrioid_carcinoma

c.562_564delTAT; p.Y188del; 10:89701924-89701926

endometriumcarcinoma; endometrioid_carcinoma

c.263A>G; p.Y88C; 10:89682759-89682759

endometriumcarcinoma; endometrioid_carcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.T321fs*3;

endometriumcarcinoma; endometrioid_carcinoma

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

endometriumcarcinoma; endometrioid_carcinoma

c.833_834insT; p.F279fs*19; 10:89710662-89710663

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.447_447delA; p.E150fs*3; 10:89682943-89682943

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.195C>A; p.Y65*; 10:89675280-89675280

endometriumcarcinoma; endometrioid_carcinoma

c.958T>G; p.L320V; 10:89710787-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.80A>G; p.Y27C; 10:89643762-89643762

endometriumcarcinoma; endometrioid_carcinoma

c.1027-2A>G; p.?; 10:89715022-89715022

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.635-2A>G; p.?; 10:89707588-89707588

endometriumcarcinoma; endometrioid_carcinoma

c.462C>A; p.F154L; 10:89682958-89682958

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.S59*;

endometriumcarcinoma; endometrioid_carcinoma

c.1022T>G; p.F341C; 10:89710851-89710851

endometriumcarcinoma; endometrioid_carcinoma

c.120_121delAA; p.R41fs*2; 10:89643802-89643803

endometriumcarcinoma; endometrioid_carcinoma

c.548_549insA; p.N184fs*6; 10:89701910-89701911

endometriumcarcinoma; endometrioid_carcinoma

c.724G>T; p.E242*;

endometriumcarcinoma; clear_cell_carcinoma

c.487A>T; p.K163*;

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.278A>G; p.H93R; 10:89682774-89682774

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.640_664del25; p.Q214fs*1; 10:89707595-89707619

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.892_892delC; p.Q298fs*9; 10:89710721-89710721

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

endometriumcarcinoma; mixed_cell_carcinoma

c.70G>T; p.D24Y; 10:89614276-89614276

endometriumcarcinoma; mixed_cell_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; serous_carcinoma

c.19G>T; p.E7*; 10:89614225-89614225

endometriumcarcinoma; serous_carcinoma

c.494G>T; p.G165V; 10:89701856-89701856

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.?; p.R130G;

ovarycarcinoma

c.?; p.Y138D;

ovarycarcinoma

c.?; p.P190L;

ovarycarcinoma

c.?; p.K267fs*?;

ovarycarcinoma

c.?; p.R130G;

ovarycarcinoma

c.?; p.R130*;

ovarycarcinoma

c.?; p.L146*;

ovarycarcinoma

c.?; p.G132V;

ovarycarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

ovarycarcinoma

c.?; p.R233*;

ovarycarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

ovarycarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

ovarycarcinoma

c.106G>A; p.G36R; 10:89643788-89643788

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.106G>A; p.G36R; 10:89643788-89643788

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.106G>A; p.G36R; 10:89643788-89643788

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.?; p.R130Q;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130Q;

endometriumcarcinoma; endometrioid_carcinoma

c.640C>T; p.Q214*; 10:89707595-89707595

lungcarcinoma; adenocarcinoma

c.331T>C; p.W111R; 10:89682827-89682827

lungcarcinoma; adenocarcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.L139*;

endometriumcarcinoma; endometrioid_carcinoma

c.376G>A; p.A126T; 10:89682872-89682872

endometriumcarcinoma; endometrioid_carcinoma

c.165G>A; p.R55R; 10:89675250-89675250

endometriumcarcinoma

c.164_165ins45; p.R55_F56ins15;

endometriumcarcinoma

c.476G>A; p.R159K; 10:89682972-89682972

skin; earmalignant_melanoma

c.800delA; p.K267fs*9; 10:89707755-89707755

central_nervous_system; brainglioma; oligodendroglioma_Grade_III

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>G; p.R130G; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.?; p.V85A;

large_intestinecarcinoma; adenocarcinoma

c.?; p.V85A;

large_intestinecarcinoma; adenocarcinoma

c.?; p.P103S;

large_intestinecarcinoma; adenocarcinoma

c.?; p.R142W;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.D24Y;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R15K;

ovarycarcinoma; endometrioid_carcinoma

c.?; p.F81C;

ovarycarcinoma; endometrioid_carcinoma

c.?; p.H61Y;

endometriumcarcinoma; endometrioid_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130G;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.Y240*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.H93Y;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130G;

endometriumcarcinoma; endometrioid_carcinoma

c.388_388delC; p.R130fs*4; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R142W;

endometriumcarcinoma; endometrioid_carcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

prostatecarcinoma; adenocarcinoma

c.172G>A; p.D58N; 10:89675257-89675257

endometriumcarcinoma

c.333G>A; p.W111*; 10:89682829-89682829

endometriumcarcinoma

c.278A>G; p.H93R; 10:89682774-89682774

endometriumcarcinoma

c.343G>A; p.D115N; 10:89682839-89682839

endometriumcarcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma

c.1069C>T; p.P357S; 10:89715066-89715066

endometriumcarcinoma

c.500C>T; p.T167I; 10:89701862-89701862

endometriumcarcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma

c.728delT; p.F243fs*13; 10:89707683-89707683

endometriumcarcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma

c.?; p.G129R;

large_intestinecarcinoma; adenocarcinoma

c.?; p.P38S;

large_intestinecarcinoma; adenocarcinoma

c.?; p.Q214*;

large_intestinecarcinoma; adenocarcinoma

c.?; p.Q171*;

large_intestinecarcinoma; adenocarcinoma

c.?; p.I32del;

large_intestinecarcinoma; adenocarcinoma

c.?; p.H61R;

large_intestinecarcinoma; adenocarcinoma

c.?; p.H61R;

large_intestinecarcinoma; adenocarcinoma

c.?; p.S59*;

large_intestinecarcinoma; adenocarcinoma

c.?; p.Q171*;

large_intestinecarcinoma; adenocarcinoma

c.?; p.Q219*;

large_intestinecarcinoma; adenocarcinoma

c.?; p.D301fs*?;

large_intestinecarcinoma; adenocarcinoma

c.?; p.H61R;

large_intestinecarcinoma; adenocarcinoma

c.?; p.D384fs*?;

large_intestinecarcinoma; adenocarcinoma

c.?; p.R142W;

large_intestinecarcinoma; adenocarcinoma

c.?; p.R173H;

large_intestinecarcinoma; adenocarcinoma

c.?; p.Y336C;

large_intestinecarcinoma; adenocarcinoma

c.56_57insGT; p.D19fs*6; 10:89614262-89614263

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.233_234insTA; p.A79fs*21; 10:89680806-89680807

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.697_698insA; p.R233fs*10; 10:89707652-89707653

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.743_744ins13; p.V249fs*8; 10:89707698-89707699

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.224_224delA; p.H75fs*24; 10:89680797-89680797

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.692_693insTGCT; p.T232fs*12; 10:89707647-89707648

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.754_755insGTGGT; p.D252fs*6; 10:89707709-89707710

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.749_750insGCCCT; p.C250fs*8; 10:89707704-89707705

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.755_756insC; p.I253fs*45; 10:89707710-89707711

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.645_646insT; p.V216fs*27; 10:89707600-89707601

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.717_718insTCCT; p.Y240fs*4; 10:89707672-89707673

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.743_744insAGTTACC; p.C250fs*5; 10:89707698-89707699

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.635_650del16; p.N212fs*4; 10:89707590-89707605

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.743_744ins13; p.V249fs*8; 10:89707698-89707699

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.724_725insTCCTTAG; p.E242fs*13; 10:89707679-89707680

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.724_725insTCCTTAA; p.E242fs*13; 10:89707679-89707680

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.714_715insTGTACTT; p.M239fs*6; 10:89707669-89707670

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.697_698insA; p.R233fs*10; 10:89707652-89707653

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.671_679del9; p.I224_S227>T; 10:89707626-89707634

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.739_755del17; p.L247fs*45; 10:89707694-89707710

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.743_744ins13; p.V249fs*8; 10:89707698-89707699

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.707_708insG; p.D236fs*7; 10:89707662-89707663

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.737_738insTCGTACCG; p.L247fs*12; 10:89707692-89707693

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.650_651insT; p.C218fs*25; 10:89707605-89707606

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.694_695ins9; p.T232_R233insK*; 10:89707649-89707650

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.738_741delGTTA; p.P248fs*7; 10:89707693-89707696

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.416_419delTATT; p.L139fs*7; 10:89682912-89682915

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.696_697insA; p.R233fs*10; 10:89707651-89707652

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.650_651insG; p.C218fs*25; 10:89707605-89707606

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.678_679insT; p.S227fs*16; 10:89707633-89707634

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.702_703insAGGA; p.E235fs*9; 10:89707657-89707658

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.696_697insG; p.R233fs*10; 10:89707651-89707652

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.700_701insCGCTCGAC; p.R234fs*25; 10:89707655-89707656

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.692_693insCCACACAG; p.T232fs*27; 10:89707647-89707648

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.753_754insCACGTGCG; p.D252fs*7; 10:89707708-89707709

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.794_795insG; p.D268fs*30; 10:89707749-89707750

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.672_673insT; p.Y225fs*18; 10:89707627-89707628

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.694_706del13; p.R233fs*19; 10:89707649-89707661

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.734_735ins13; p.Q245fs*12; 10:89707689-89707690

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.714_715ins12; p.F238_M239insFIT*; 10:89707669-89707670

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.734_735ins13; p.Q245fs*2; 10:89707689-89707690

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.705_706insC; p.D236fs*7; 10:89707660-89707661

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.652_653insA; p.C218fs*1; 10:89707607-89707608

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.716_717insC; p.M239fs*4; 10:89707671-89707672

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.697_698insG; p.R234fs*9; 10:89707652-89707653

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.696_697insGGGACTTA; p.R233fs*26; 10:89707651-89707652

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.709_710insGAAAGCCA; p.K237fs*22; 10:89707664-89707665

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.13_14insA; p.I5fs*6; 10:89614219-89614220

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.708_709insCGAAAGCC; p.K237fs*22; 10:89707663-89707664

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.736_737insAG; p.P246fs*11; 10:89707691-89707692

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.737_738insTA; p.L247fs*10; 10:89707692-89707693

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.734_735ins11; p.Q245fs*15; 10:89707689-89707690

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.699_700insT; p.R234fs*9; 10:89707654-89707655

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.739_740insAAGG; p.L247fs*1; 10:89707694-89707695

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.381_387delAAAGGGA; p.K128fs*4; 10:89682877-89682883

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.738_739insATAACGTG; p.L247fs*12; 10:89707693-89707694

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.685_686ins10; p.T232fs*14; 10:89707640-89707641

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.736_737insT; p.P246fs*7; 10:89707691-89707692

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R173S;

eyemalignant_melanoma

c.1_1212del1212; p.0?;

skinmalignant_melanoma

c.?; p.G132C;

skinmalignant_melanoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma

c.320_338del19; p.D107fs*21; 10:89682816-89682834

large_intestinecarcinoma; adenocarcinoma

c.209+2T>C; p.?; 10:89675296-89675296

large_intestinecarcinoma; adenocarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

large_intestinecarcinoma; adenocarcinoma

c.737C>T; p.P246L; 10:89707692-89707692

large_intestinecarcinoma; adenocarcinoma

c.464A>G; p.Y155C; 10:89682960-89682960

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

large_intestinecarcinoma; adenocarcinoma

c.810_811insA; p.F271fs*27; 10:89710639-89710640

large_intestinecarcinoma; adenocarcinoma

c.994_995delAA; p.K332fs*10; 10:89710823-89710824

large_intestinecarcinoma; adenocarcinoma

c.409G>A; p.A137T; 10:89682905-89682905

large_intestinecarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestinecarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

large_intestinecarcinoma; adenocarcinoma

c.412T>G; p.Y138D; 10:89682908-89682908

large_intestinecarcinoma; adenocarcinoma

c.461_462insATTT; p.F154fs*27; 10:89682957-89682958

large_intestinecarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

large_intestinecarcinoma; adenocarcinoma

c.460T>G; p.F154V; 10:89682956-89682956

large_intestinecarcinoma; adenocarcinoma

c.463T>C; p.Y155H; 10:89682959-89682959

large_intestinecarcinoma; adenocarcinoma

c.517C>T; p.R173C; 10:89701879-89701879

large_intestinecarcinoma; adenocarcinoma

c.242T>G; p.F81C; 10:89680815-89680815

large_intestinecarcinoma; adenocarcinoma

c.430A>C; p.K144Q; 10:89682926-89682926

large_intestinecarcinoma; adenocarcinoma

c.469G>A; p.E157K; 10:89682965-89682965

large_intestinecarcinoma; adenocarcinoma

c.518G>A; p.R173H; 10:89701880-89701880

large_intestinecarcinoma; adenocarcinoma

c.895G>T; p.E299*; 10:89710724-89710724

large_intestinecarcinoma; adenocarcinoma

c.358G>A; p.A120T; 10:89682854-89682854

large_intestinecarcinoma; adenocarcinoma

c.358G>A; p.A120T; 10:89682854-89682854

large_intestinecarcinoma; adenocarcinoma

c.611C>T; p.P204L; 10:89701973-89701973

large_intestinecarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestinecarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestinecarcinoma; adenocarcinoma

c.401T>C; p.M134T; 10:89682897-89682897

large_intestinecarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestinecarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestinecarcinoma; adenocarcinoma

c.376G>T; p.A126S; 10:89682872-89682872

large_intestinecarcinoma; adenocarcinoma

c.187A>T; p.N63Y; 10:89675272-89675272

large_intestinecarcinoma; adenocarcinoma

c.634+5G>A; p.?; 10:89702001-89702001

large_intestinecarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestinecarcinoma; adenocarcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

large_intestinecarcinoma; adenocarcinoma

c.188delA; p.N63fs*36; 10:89675273-89675273

large_intestinecarcinoma; adenocarcinoma

c.635-4G>A; p.?; 10:89707586-89707586

large_intestinecarcinoma; adenocarcinoma

c.559G>T; p.D187Y; 10:89701921-89701921

large_intestinecarcinoma; adenocarcinoma

c.517C>T; p.R173C; 10:89701879-89701879

large_intestinecarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestinecarcinoma; adenocarcinoma

c.549G>T; p.K183N; 10:89701911-89701911

large_intestinecarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

large_intestinecarcinoma; adenocarcinoma

c.375_400del26; p.K125fs*46; 10:89682871-89682896

large_intestinecarcinoma; adenocarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.766G>C; p.E256Q; 10:89707721-89707721

large_intestinecarcinoma; adenocarcinoma

c.754G>T; p.D252Y; 10:89707709-89707709

large_intestinecarcinoma; adenocarcinoma

c.203A>G; p.Y68C; 10:89675288-89675288

large_intestinecarcinoma; adenocarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

large_intestinecarcinoma; adenocarcinoma

c.106G>A; p.G36R; 10:89643788-89643788

soft_tissue; fibrous_tissue_and_uncertain_osynovial_sarcoma

c.767_768delAG; p.E256fs*41; 10:89707722-89707723

central_nervous_system; cerebellumother; gangliocytoma

c.1_1212del1212; p.0?;

urinary_tract; bladdercarcinoma; transitional_cell_carcinoma

c.1_1212del1212; p.0?;

urinary_tract; bladdercarcinoma; transitional_cell_carcinoma

c.?; p.G36E;

stomachcarcinoma; intestinal_adenocarcinoma

c.?; p.H397Y;

stomachcarcinoma; diffuse_adenocarcinoma

c.103A>C; p.M35L; 10:89643785-89643785

breastcarcinoma; ductal_carcinoma

c.963_964insA; p.T321fs*3; 10:89710792-89710793

endometriumcarcinoma; endometrioid_carcinoma

c.1008C>A; p.Y336*; 10:89710837-89710837

endometriumcarcinoma; endometrioid_carcinoma

c.389G>C; p.R130P; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.907_907delA; p.I303fs*4; 10:89710736-89710736

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.962_962C>AT; p.T321fs*4; 10:89710791-89710791

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.208C>A; p.L70I; 10:89675293-89675293

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.431A>C; p.K144T;

endometriumcarcinoma; endometrioid_carcinoma

c.601G>T; p.E201*;

endometriumcarcinoma; endometrioid_carcinoma

c.640_655>ACT; p.Q214fs*3; 10:89707595-89707610

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.405_406delAT; p.I135fs*44; 10:89682901-89682902

endometriumcarcinoma; endometrioid_carcinoma

c.1028T>G; p.V343G; 10:89715025-89715025

endometriumcarcinoma; endometrioid_carcinoma

c.64_70delGACTTAG; p.D22fs*2; 10:89614270-89614276

endometriumcarcinoma; endometrioid_carcinoma

c.710_710delA; p.K237fs*19; 10:89707665-89707665

endometriumcarcinoma; endometrioid_carcinoma

c.80A>G; p.Y27C; 10:89643762-89643762

endometriumcarcinoma; endometrioid_carcinoma

c.38_39insC; p.K13fs*31; 10:89614244-89614245

endometriumcarcinoma; clear_cell_carcinoma

c.440_441insA; p.A148fs*32; 10:89682936-89682937

endometriumcarcinoma; endometrioid_carcinoma

c.562_576>C; p.Y188fs*9; 10:89701924-89701938

endometriumcarcinoma; endometrioid_carcinoma

c.103A>G; p.M35V; 10:89643785-89643785

endometriumcarcinoma; endometrioid_carcinoma

c.276C>G; p.D92E;

endometriumcarcinoma; endometrioid_carcinoma

c.263A>G; p.Y88C; 10:89682759-89682759

endometriumcarcinoma; endometrioid_carcinoma

c.611delC; p.P204fs*17; 10:89701973-89701973

endometriumcarcinoma; endometrioid_carcinoma

c.796A>T; p.K266*;

endometriumcarcinoma; endometrioid_carcinoma

c.333G>A; p.W111*; 10:89682829-89682829

skin; acralmalignant_melanoma; acral_lentiginous

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma

c.401T>G; p.M134R; 10:89682897-89682897

endometriumcarcinoma

c.400A>T; p.M134L; 10:89682896-89682896

endometriumcarcinoma

c.389G>T; p.R130L; 10:89682885-89682885

breastcarcinoma; HER-positive_carcinoma

c.493_1212del720; p.G165_*404del; 10:89701855-89715209

breastcarcinoma; ER-PR-positive_carcinoma

c.?_?del19; p.135fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.K267fs*?;

endometriumcarcinoma; mixed_cell_carcinoma

c.?; p.R130G;

endometriumcarcinoma; mixed_cell_carcinoma

c.?; p.Q171*;

lungcarcinoma; adenocarcinoma

c.654C>T; p.C218C; 10:89707609-89707609

lungcarcinoma; squamous_cell_carcinoma

c.1016C>T; p.P339L; 10:89710845-89710845

lungcarcinoma; adenocarcinoma

c.881G>A; p.S294N; 10:89710710-89710710

lungcarcinoma; squamous_cell_carcinoma

c.883C>T; p.L295L; 10:89710712-89710712

lungcarcinoma; squamous_cell_carcinoma

c.858C>T; p.T286T; 10:89710687-89710687

lungcarcinoma; mixed_adenosquamous_carcinoma

c.1_1212del1212; p.0?;

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.1_1212del1212; p.0?;

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.1_1212del1212; p.0?;

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.?; p.F241_E242insD;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.M239fs*3;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.80_1212del1133; p.?;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233fs*3;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.Q245fs*8;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233fs*10;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.Q245_P246insQSPG;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233fs*10;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.L247_P248insNILL;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.T232_R233insTQGGAGS;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.E235fs*10;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.80_1212del1133; p.?;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.D252G;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.L247fs*10;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.R233fs*24;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.T232fs*25;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.E242*;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.T232_R233insTQGGAGS;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.?; p.T232_R233insPQGGAGT;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma

c.528T>G; p.Y176*; 10:89701890-89701890

livercarcinoma; hepatocellular_carcinoma

c.961_962ins29; p.T321fs*6; 10:89710790-89710791

pancreascarcinoid-endocrine_tumour

c.?; p.N49I;

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.323T>G; p.L108R; 10:89682819-89682819

pancreascarcinoid-endocrine_tumour; islet_cell

c.227_228insT; p.D77fs*1;

NSmalignant_melanoma

c.227_228insT; p.D77fs*1;

NSmalignant_melanoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

skin; upper_legmalignant_melanoma

c.376G>A; p.A126T; 10:89682872-89682872

endometriumcarcinoma

c.107G>A; p.G36E; 10:89643789-89643789

endometriumcarcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma

c.544T>G; p.L182V;

NSmalignant_melanoma

c.389G>A; p.R130Q; 10:89682885-89682885

lungcarcinoma; small_cell_carcinoma

c.455T>C; p.L152P;

lungcarcinoma; small_cell_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestine; coloncarcinoma; adenocarcinoma

c.8C>A; p.A3D; 10:89614214-89614214

large_intestine; coloncarcinoma; adenocarcinoma

c.374A>C; p.K125T;

large_intestine; coloncarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

large_intestine; coloncarcinoma; adenocarcinoma

c.84T>G; p.I28M; 10:89643766-89643766

large_intestine; coloncarcinoma; adenocarcinoma

c.277C>T; p.H93Y; 10:89682773-89682773

large_intestine; coloncarcinoma; adenocarcinoma

c.430A>C; p.K144Q; 10:89682926-89682926

salivary_glandcarcinoma; adenoid_cystic_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

salivary_glandcarcinoma; adenoid_cystic_carcinoma

c.?; p.R173C;

urinary_tractcarcinoma

c.?; p.R130Q;

urinary_tractcarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma

c.445C>T; p.Q149*; 10:89682941-89682941

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.416T>G; p.L139*; 10:89682912-89682912

endometriumcarcinoma

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>C; p.C105S; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.371G>C; p.C124S; 10:89682867-89682867

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.511C>T; p.Q171*; 10:89701873-89701873

central_nervous_system; brainglioma; ependymoma_Grade_III-IV

c.922C>T; p.R308C; 10:89710751-89710751

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.686C>G; p.S229*; 10:89707641-89707641

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.178A>T; p.K60*; 10:89675263-89675263

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.253+1G>C; p.?; 10:89680827-89680827

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.116_117insG; p.A39fs*5; 10:89643798-89643799

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.271G>C; p.E91Q; 10:89682767-89682767

stomachcarcinoma; signet_ring_adenocarcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

stomachcarcinoma; adenocarcinoma

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.511C>T; p.Q171*; 10:89701873-89701873

central_nervous_system; brainglioma; ependymoma_Grade_III-IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>C; p.C105S; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.371G>C; p.C124S; 10:89682867-89682867

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.871G>A; p.E291K; 10:89710700-89710700

endometriumcarcinoma; endometrioid_carcinoma

c.863delA; p.E288fs*3; 10:89710692-89710692

endometriumcarcinoma; endometrioid_carcinoma

c.945_946insG; p.Y315fs*9; 10:89710774-89710775

endometriumcarcinoma; endometrioid_carcinoma

c.987_990delTAAA; p.N329fs*14; 10:89710816-89710819

endometriumcarcinoma; endometrioid_carcinoma

c.863delA; p.E288fs*3; 10:89710692-89710692

endometriumcarcinoma; endometrioid_carcinoma

c.446A>G; p.Q149R; 10:89682942-89682942

endometriumcarcinoma; endometrioid_carcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

endometriumcarcinoma; endometrioid_carcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.922_923insA; p.R308fs*4; 10:89710751-89710752

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.697C>A; p.R233R; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.76A>C; p.T26P; 10:89614282-89614282

endometriumcarcinoma; endometrioid_carcinoma

c.815A>G; p.H272R; 10:89710644-89710644

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.336_340delAAGTG; p.L112fs*3; 10:89682832-89682836

endometriumcarcinoma; endometrioid_carcinoma

c.956_959delCTTT; p.T319fs*24; 10:89710785-89710788

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.462C>A; p.F154L; 10:89682958-89682958

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.424C>T; p.R142W; 10:89682920-89682920

endometriumcarcinoma; endometrioid_carcinoma

c.879A>C; p.G293G; 10:89710708-89710708

stomachcarcinoma; adenocarcinoma

c.202T>C; p.Y68H; 10:89675287-89675287

pancreascarcinoid-endocrine_tumour

c.634+1G>A; p.?; 10:89701997-89701997

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.638C>A; p.P213H; 10:89707593-89707593

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.822G>A; p.W274*; 10:89710651-89710651

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.146A>C; p.N49T; 10:89643828-89643828

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.586_587insG; p.H196fs*6; 10:89701948-89701949

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.766G>A; p.E256K; 10:89707721-89707721

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1007_1008insA; p.Y336*; 10:89710836-89710837

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.733C>T; p.Q245*; 10:89707688-89707688

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.760_764delAAAGT; p.K254fs*42; 10:89707715-89707719

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.375A>C; p.K125N; 10:89682871-89682871

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1-9C>G; p.?; 10:89614198-89614198

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1-9C>G; p.?; 10:89614198-89614198

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.953_956delTTAC; p.L318fs*2; 10:89710782-89710785

ovarycarcinoma; endometrioid_carcinoma

c.241_242TT>G; p.F81fs*18;

ovarycarcinoma; endometrioid_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

ovarycarcinoma; endometrioid_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

ovarycarcinoma; endometrioid_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

ovarycarcinoma; clear_cell_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

soft_tissue; fibrous_tissue_and_uncertain_omalignant_fibrous_histiocytoma-pleomorphic_sarcoma

c.509G>A; p.S170N; 10:89701871-89701871

biliary_tract; bile_ductcarcinoma; adenocarcinoma

c.?; p.L112Q;

NSmalignant_melanoma

c.?; p.V175fs*3;

NSmalignant_melanoma

c.?; p.R130Q;

NSmalignant_melanoma

c.?; p.K128_R130del;

ovarycarcinoma

c.383_391del9; p.K128_R130del; 10:89682879-89682887

ovarycarcinoma

c.?; p.K128_R130del;

ovarycarcinoma; serous_carcinoma

c.94_96delATT; p.I32del; 10:89643776-89643778

pancreascarcinoma; acinar_carcinoma

c.863delA; p.E288fs*3; 10:89710692-89710692

pancreascarcinoma; acinar_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; adenocarcinoma

c.?; p.R130fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R173C;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_leukaemia

c.740_741delTA; p.L247fs*5; 10:89707695-89707696

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; primary_effusion_lymphoma

c.564T>A; p.Y188*; 10:89701926-89701926

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; Burkitt_lymphoma

c.90delA; p.N31fs*23;

livercarcinoma

c.530A>G; p.Y177C; 10:89701892-89701892

livercarcinoma

c.743_744insC; p.V249fs*4; 10:89707698-89707699

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.592_594delATG; p.M198del; 10:89701954-89701956

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1_1212del1212; p.0?; 10:89614207-89715209

breastcarcinoma

c.821delG; p.V275fs*1;

breastcarcinoma

c.823delG; p.V275fs*1; 10:89710652-89710652

breastcarcinoma

c.823delG; p.V275fs*1; 10:89710652-89710652

breastcarcinoma; ductal_carcinoma

c.821delG; p.V275fs*1;

breastcarcinoma

c.821delG; p.V275fs*1;

breastcarcinoma; basal_(triple-negative)_carcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.802-1G>A; p.?; 10:89710630-89710630

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.394G>A; p.G132S; 10:89682890-89682890

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1133_1136delGATA; p.R378fs*>25; 10:89715130-89715133

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.287C>T; p.P96L; 10:89682783-89682783

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.263A>G; p.Y88C; 10:89682759-89682759

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.17A>T; p.K6I; 10:89614223-89614223

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.461delT; p.F154fs*5; 10:89682957-89682957

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.385G>T; p.G129*; 10:89682881-89682881

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.951_954delACTT; p.L318fs*2; 10:89710780-89710783

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.54_55delGG; p.D19fs*24; 10:89614260-89614261

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1027-1G>A; p.?; 10:89715023-89715023

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.253+1G>A; p.?; 10:89680827-89680827

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1131_1134delTAGA; p.R378fs*>25; 10:89715128-89715131

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.389G>C; p.R130P; 10:89682885-89682885

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.209+4A>T; p.?; 10:89675298-89675298

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>G; p.R130G; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.164+1G>T; p.?; 10:89643847-89643847

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.271G>T; p.E91*; 10:89682767-89682767

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.461delT; p.F154fs*5; 10:89682957-89682957

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.158_160delTAG; p.V53del; 10:89643840-89643842

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.355G>T; p.V119F; 10:89682851-89682851

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.164+1delG; p.?; 10:89643847-89643847

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1026+2T>G; p.?; 10:89710857-89710857

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.75G>C; p.L25F; 10:89614281-89614281

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

cervixcarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

cervixcarcinoma; adenocarcinoma

c.274G>C; p.D92H; 10:89682770-89682770

breastcarcinoma

c.802_837GACAAAATGTTTCACTTTTGGGTAAATACATTCTTC>36; p.D268_F279>12;

breastcarcinoma

c.274G>C; p.D92H; 10:89682770-89682770

breastcarcinoma; luminal_NS_carcinoma

c.802_837GACAAAATGTTTCACTTTTGGGTAAATACATTCTTC>36; p.D268_F279>12;

breastcarcinoma; luminal_NS_carcinoma

c.1_1212del1212; p.0?;

NSmalignant_melanoma

c.1-?_164+?del; p.M1_?del fs;

skinmalignant_melanoma

c.?; p.W274G;

ovarycarcinoma; serous_carcinoma

c.353A>G; p.H118R;

haematopoietic_and_lymphoid_tissuehaematopoietic_neoplasm; chronic_myelomonocytic_leukaemia

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma

c.820_1023del204; p.W274_F341del; 10:89710649-89710852

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.253+5G>T; p.?; 10:89680831-89680831

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm

c.253+5G>T; p.?; 10:89680831-89680831

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm

c.210-52delT; p.?; 10:89680731-89680731

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm

c.?; p.K128N;

lungcarcinoma

c.400A>T; p.M134L; 10:89682896-89682896

prostatecarcinoma; adenocarcinoma

c.389G>C; p.R130P; 10:89682885-89682885

endometriumcarcinoma; mixed_serous_and_endometrioid_carcinoma

c.279_304del26; p.H93fs*5; 10:89682775-89682800

endometriumcarcinoma; endometrioid_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.955_956insA; p.T319fs*6; 10:89710784-89710785

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.170_171insT; p.L57fs*6; 10:89675255-89675256

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.1026+1G>A; p.?; 10:89710856-89710856

endometriumcarcinoma; endometrioid_carcinoma

c.391delA; p.T131fs*3; 10:89682887-89682887

endometriumcarcinoma; endometrioid_carcinoma

c.340G>T; p.E114*; 10:89682836-89682836

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.408_409insGGNATG; p.C136_A137insGM; 10:89682904-89682905

endometriumcarcinoma; endometrioid_carcinoma

c.249C>A; p.C83*; 10:89680822-89680822

endometriumcarcinoma; endometrioid_carcinoma

c.526_528delTAT; p.Y176del; 10:89701888-89701890

endometriumcarcinoma; endometrioid_carcinoma

c.17_18delAA; p.K6fs*4; 10:89614223-89614224

endometriumcarcinoma; mixed_serous_and_endometrioid_carcinoma

c.406_407insA; p.C136fs*1; 10:89682902-89682903

endometriumcarcinoma; mixed_serous_and_endometrioid_carcinoma

c.923delG; p.R308fs*9; 10:89710752-89710752

endometriumcarcinoma; mixed_serous_and_endometrioid_carcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.1027-2A>G; p.?; 10:89715022-89715022

endometriumcarcinoma; endometrioid_carcinoma

c.503delT; p.S170fs*13;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.V317fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.V290fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

ovarycarcinoma

c.?; p.K267fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.Y88C;

endometriumcarcinoma

c.18A>T; p.K6N;

oesophagus; lower_thirdcarcinoma; adenocarcinoma

c.198G>T; p.K66N; 10:89675283-89675283

oesophagus; lower_thirdcarcinoma; adenocarcinoma

c.991G>C; p.D331H;

oesophaguscarcinoma; adenocarcinoma

c.134T>C; p.V45A;

oesophaguscarcinoma; adenocarcinoma

c.752G>T; p.G251V; 10:89707707-89707707

oesophaguscarcinoma; adenocarcinoma

c.?; p.R142W;

endometriumcarcinoma

c.634+5G>T; p.?; 10:89702001-89702001

skinmalignant_melanoma

c.?; p.I122V;

endometriumcarcinoma

c.?; p.R130L;

endometriumcarcinoma

c.951_954delACTT; p.V317fs*3; 10:89710780-89710783

breastcarcinoma

c.951_954delACTT; p.V317fs*3; 10:89710780-89710783

breastcarcinoma; luminal_NS_carcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma

c.493-?_1026+?del; p.G165_K342del;

skinmalignant_melanoma

c.675_676insTA; p.Y225fs*31; 10:89707630-89707631

skinmalignant_melanoma

c.165-18T>A; p.?; 10:89675232-89675232

skinmalignant_melanoma

c.949_966del18; p.V317_K322del; 10:89710778-89710795

skinmalignant_melanoma

c.?; p.L139*;

skinmalignant_melanoma

c.416T>G; p.L139*; 10:89682912-89682912

skinmalignant_melanoma

c.1-?_164+?del; p.M1_?del fs;

skinmalignant_melanoma

c.112C>T; p.P38S; 10:89643794-89643794

skinmalignant_melanoma

c.380G>A; p.G127E; 10:89682876-89682876

skinmalignant_melanoma

c.380G>A; p.G127E; 10:89682876-89682876

skinmalignant_melanoma

c.640C>T; p.Q214*; 10:89707595-89707595

skinmalignant_melanoma

c.1-?_492+?del; p.?;

skinmalignant_melanoma

c.1-?_164+?del; p.M1_?del fs;

skinmalignant_melanoma

c.?; p.R130*;

thyroidcarcinoma; follicular_carcinoma

c.1-?_79+?del; p.M1_?del fs;

skinmalignant_melanoma

c.182A>G; p.H61R; 10:89675267-89675267

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.182A>G; p.H61R; 10:89675267-89675267

lungcarcinoma; small_cell_carcinoma

c.244_285del42; p.N82_P95del; 10:89680817-89682781

lungcarcinoma; small_cell_carcinoma

c.490A>T; p.K164*; 10:89682986-89682986

lungcarcinoma; small_cell_carcinoma

c.1-?_492+?del; p.?;

lungcarcinoma; small_cell_carcinoma

c.?; p.R130Q;

large_intestinecarcinoma; adenocarcinoma

c.?; p.Y46C;

large_intestinecarcinoma; adenocarcinoma

c.?; p.F341V;

large_intestinecarcinoma; adenocarcinoma

c.1_1212del1212; p.0?;

breastcarcinoma

c.1_1212del1212; p.0?; 10:89614207-89715209

breastcarcinoma; basal_(triple-negative)_carcinoma

c.137A>G; p.Y46C;

large_intestine; coloncarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

large_intestine; coloncarcinoma; adenocarcinoma

c.1021T>G; p.F341V; 10:89710850-89710850

large_intestine; coloncarcinoma; adenocarcinoma

c.70G>C; p.D24H;

livercarcinoma; hepatocellular_carcinoma

c.389G>C; p.R130P; 10:89682885-89682885

livercarcinoma

c.?; p.K6fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.E288fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R55_L70>S;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R173C;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.Y76fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.I33del;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.S10N;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.E299*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.L318fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.Y46H;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.P246L;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.L265fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R233*;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.V290fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.V85fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.Y46H;

endometriumcarcinoma

c.?; p.P246L;

endometriumcarcinoma

c.?; p.R233*;

endometriumcarcinoma

c.508_508delA; p.S170fs*13; 10:89701870-89701870

lungcarcinoma; squamous_cell_carcinoma

c.176C>T; p.S59L; 10:89675261-89675261

lungcarcinoma; squamous_cell_carcinoma

c.99_107del9; p.A34_G36del; 10:89643781-89643789

stomachcarcinoma; diffuse_adenocarcinoma

c.112C>T; p.P38S; 10:89643794-89643794

skinmalignant_melanoma

c.517C>T; p.R173C; 10:89701879-89701879

skinmalignant_melanoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestinecarcinoma; adenocarcinoma

c.8C>A; p.A3D; 10:89614214-89614214

large_intestinecarcinoma; adenocarcinoma

c.84T>G; p.I28M; 10:89643766-89643766

large_intestinecarcinoma; adenocarcinoma

c.91A>C; p.N31H; 10:89643773-89643773

large_intestinecarcinoma; adenocarcinoma

c.781C>T; p.Q261*; 10:89707736-89707736

skinmalignant_melanoma

c.797_797delA; p.K267fs*9; 10:89707752-89707752

lungcarcinoma; squamous_cell_carcinoma

c.?; p.V290fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.K164fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.42G>T; p.R14S;

upper_aerodigestive_tract; head_neckcarcinoma; squamous_cell_carcinoma

c.276C>G; p.D92E;

upper_aerodigestive_tract; head_neckcarcinoma; squamous_cell_carcinoma

c.276C>G; p.D92E;

upper_aerodigestive_tract; mouthcarcinoma; squamous_cell_carcinoma

c.634+1G>A; p.?; 10:89701997-89701997

upper_aerodigestive_tract; head_neckcarcinoma; squamous_cell_carcinoma

c.754G>T; p.D252Y; 10:89707709-89707709

upper_aerodigestive_tract; head_neckcarcinoma; squamous_cell_carcinoma

c.754G>T; p.D252Y; 10:89707709-89707709

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.737C>T; p.P246L; 10:89707692-89707692

upper_aerodigestive_tract; head_neckcarcinoma; squamous_cell_carcinoma

c.737C>T; p.P246L; 10:89707692-89707692

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

upper_aerodigestive_tract; head_neckcarcinoma; squamous_cell_carcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

upper_aerodigestive_tract; mouthcarcinoma; squamous_cell_carcinoma

c.973C>G; p.L325V;

upper_aerodigestive_tract; mouthcarcinoma; squamous_cell_carcinoma

c.477G>T; p.R159S; 10:89682973-89682973

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.210-52delT; p.?; 10:89680731-89680731

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm

c.49C>T; p.Q17*; 10:89614255-89614255

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; plasma_cell_myeloma

c.385G>T; p.G129*; 10:89682881-89682881

large_intestine; rectumcarcinoma; adenocarcinoma

c.256G>C; p.A86P; 10:89682752-89682752

large_intestine; caecumcarcinoma; adenocarcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

ovarycarcinoma

c.464A>G; p.Y155C; 10:89682960-89682960

ovarycarcinoma

c.?; p.Y155C;

ovarycarcinoma; serous_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; adenocarcinoma

c.867delA; p.V290fs*1; 10:89710696-89710696

endometriumcarcinoma; adenocarcinoma

c.?; p.V317fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.V290fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.699_700AC>GGCCCATGG; p.R234fs*11; 10:89707654-89707655

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.634+5G>T; p.?; 10:89702001-89702001

skinmalignant_melanoma

c.801+?del?; p.?;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; plasma_cell_myeloma

c.740T>R; p.L247*; 10:89707695-89707695

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm

c.699_700AC>GGCCCATGG; p.R234fs*11; 10:89707654-89707655

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm

c.1003C>T; p.R335*; 10:89710832-89710832

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.1003C>T; p.R335*; 10:89710832-89710832

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.107G>A; p.G36E; 10:89643789-89643789

central_nervous_system; brainglioma

c.?; p.G129*;

large_intestinecarcinoma; adenocarcinoma

c.?_?del?; p.K267fs*9;

large_intestinecarcinoma; adenocarcinoma

c.385G>T; p.G129*; 10:89682881-89682881

large_intestine; coloncarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

autonomic_ganglianeuroblastoma

c.464A>G; p.Y155C; 10:89682960-89682960

skin; armmalignant_melanoma

c.367C>T; p.H123Y; 10:89682863-89682863

lungcarcinoma; adenocarcinoma

c.314G>T; p.C105F; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.44G>T; p.R15I; 10:89614250-89614250

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.45A>T; p.R15S; 10:89614251-89614251

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.528T>G; p.Y176*; 10:89701890-89701890

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.81T>G; p.Y27*; 10:89643763-89643763

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.548_549insA; p.N184fs*6; 10:89701910-89701911

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1027-1G>A; p.?; 10:89715023-89715023

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.17_18delAA; p.K6fs*4; 10:89614223-89614224

prostatecarcinoma; adenocarcinoma

c.16_17delAA; p.K6fs*4; 10:89614222-89614223

prostatecarcinoma; adenocarcinoma

c.16_17delAA; p.K6fs*4; 10:89614222-89614223

prostatecarcinoma; adenocarcinoma

c.752G>A; p.G251D; 10:89707707-89707707

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.263_264delAT; p.Y88fs*3; 10:89682759-89682760

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.802-1G>A; p.?; 10:89710630-89710630

lungcarcinoma; adenocarcinoma

c.332G>A; p.W111*; 10:89682828-89682828

lungcarcinoma; adenocarcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

lungcarcinoma; adenocarcinoma

c.49C>T; p.Q17*; 10:89614255-89614255

lungcarcinoma; adenocarcinoma

c.48T>C; p.Y16Y;

lungcarcinoma; adenocarcinoma

c.479C>T; p.T160I; 10:89682975-89682975

eye; uveal_tractmalignant_melanoma

c.492+14T>C; p.?; 10:89683002-89683002

eye; uveal_tractmalignant_melanoma

c.262T>C; p.Y88H; 10:89682758-89682758

eye; uveal_tractmalignant_melanoma

c.492+14T>C; p.?; 10:89683002-89683002

eye; uveal_tractmalignant_melanoma

c.283C>T; p.P95S; 10:89682779-89682779

eye; uveal_tractmalignant_melanoma

c.253+3A>G; p.?; 10:89680829-89680829

eye; uveal_tractmalignant_melanoma

c.922C>T; p.R308C; 10:89710751-89710751

eye; uveal_tractmalignant_melanoma

c.1_1212del1212; p.0?;

NSmalignant_melanoma

c.1_1212del1212; p.0?; 10:89614207-89715209

skinmalignant_melanoma

c.1_1212del1212; p.0?; 10:89614207-89715209

skinmalignant_melanoma

c.1_1212del1212; p.0?; 10:89614207-89715209

skinmalignant_melanoma

c.1_1212del1212; p.0?; 10:89614207-89715209

skinmalignant_melanoma

c.1_1212del1212; p.0?;

NSmalignant_melanoma

c.?; p.G165*;

skinmalignant_melanoma

c.1_1212del1212; p.0?;

NSmalignant_melanoma

c.1_1212del1212; p.0?;

NSmalignant_melanoma

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; medullaprimitive_neuroectodermal_tumour-medulloblastoma; classic

c.632_633insGC; p.C211fs*11;

central_nervous_system; medullaprimitive_neuroectodermal_tumour-medulloblastoma; large_cell

c.724G>T; p.E242*;

central_nervous_system; medullaprimitive_neuroectodermal_tumour-medulloblastoma; classic

c.277C>T; p.H93Y; 10:89682773-89682773

central_nervous_system; brainprimitive_neuroectodermal_tumour-medulloblastoma

c.494G>A; p.G165E; 10:89701856-89701856

central_nervous_system; brainprimitive_neuroectodermal_tumour-medulloblastoma

c.407G>A; p.C136Y; 10:89682903-89682903

breastcarcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

breastcarcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

breastcarcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

breastcarcinoma; luminal_NS_carcinoma

c.919G>A; p.E307K;

breastcarcinoma

c.919G>A; p.E307K;

breastcarcinoma; ductal_carcinoma

c.919G>A; p.E307K;

breastcarcinoma; luminal_NS_carcinoma

c.253+1G>T; p.?; 10:89680827-89680827

breastcarcinoma

c.208_251del44; p.L70fs*7; 10:89675293-89680824

breastcarcinoma

c.208_251del44; p.L70fs*7; 10:89675293-89680824

breastcarcinoma

c.253+1G>T; p.?; 10:89680827-89680827

breastcarcinoma; basal_(triple-negative)_carcinoma

c.253+1G>T; p.?; 10:89680827-89680827

haematopoietic_and_lymphoid_tissuehaematopoietic_neoplasm; myelodysplastic_syndrome

c.389G>A; p.R130Q; 10:89682885-89682885

prostatecarcinoma

c.752G>A; p.G251D; 10:89707707-89707707

skin; trunkmalignant_melanoma

c.752G>A; p.G251D; 10:89707707-89707707

skin; trunkmalignant_melanoma

c.737_738insGTAA; p.L247fs*1;

skin; trunkmalignant_melanoma

c.877G>T; p.G293*; 10:89710706-89710706

skinmalignant_melanoma

c.380G>A; p.G127E; 10:89682876-89682876

skin; upper_armmalignant_melanoma

c.112C>T; p.P38S; 10:89643794-89643794

skin; scalpmalignant_melanoma

c.384G>T; p.K128N; 10:89682880-89682880

skin; lower_legmalignant_melanoma

c.485A>T; p.D162V;

skin; abdomenmalignant_melanoma

c.469G>T; p.E157*;

skin; abdomenmalignant_melanoma

c.640C>T; p.Q214*; 10:89707595-89707595

skin; lower_legmalignant_melanoma

c.94_96delATT; p.I32del; 10:89643776-89643778

NSmalignant_melanoma

c.635-2_645delagATCCTCAGTTT; p.?;

skin; backmalignant_melanoma

c.811T>A; p.F271I;

skinmalignant_melanoma

c.112C>T; p.P38S; 10:89643794-89643794

skinmalignant_melanoma

c.?; p.R130Q;

endometriumcarcinoma

c.?; p.N323fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.R130Q;

endometriumcarcinoma; endometrioid_carcinoma

c.80-?_634+?del; p.Y27_N212>Y;

skinmalignant_melanoma

c.800delA; p.K267fs*9; 10:89707755-89707755

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.800delA; p.K267fs*9; 10:89707755-89707755

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_leukaemia

c.1_1212del1212; p.0?;

skinmalignant_melanoma; lentigo_maligna

c.?; p.K128N;

skinmalignant_melanoma

c.?; p.E157*;

skinmalignant_melanoma; nodular

c.?; p.D162V;

skinmalignant_melanoma; nodular

c.1_1212del1212; p.0?;

skinmalignant_melanoma

c.?; p.F90_P95>L;

skinmalignant_melanoma; amelanotic

c.?; p.L108P;

skinmalignant_melanoma; superficial_spreading

c.?; p.P38S;

skinmalignant_melanoma; superficial_spreading

c.?; p.H118L;

skinmalignant_melanoma; superficial_spreading

c.1_1212del1212; p.0?;

NSmalignant_melanoma

c.80_164del85; p.?; 10:89643762-89643846

NSmalignant_melanoma

c.?; p.C71W;

NSmalignant_melanoma

c.?; p.P38L;

skinmalignant_melanoma

c.?; p.R130Q;

skinmalignant_melanoma

c.?; p.K13fs*?;

NSmalignant_melanoma

c.1_1212del1212; p.0?;

skin; mucosalmalignant_melanoma

c.1_1212del1212; p.0?;

skinmalignant_melanoma; nodular

c.?; p.I32del;

NSmalignant_melanoma

c.1_1212del1212; p.0?;

skinmalignant_melanoma; nodular

c.?; p.L247*;

NSmalignant_melanoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestine; coloncarcinoma; adenocarcinoma

c.1-?_79+?del; p.M1_?del fs;

lungcarcinoma; small_cell_carcinoma

c.1-?_79+?del; p.M1_?del fs;

lungcarcinoma; small_cell_carcinoma

c.1-?_79+?del; p.M1_?del fs;

lungcarcinoma; small_cell_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

lungcarcinoma; large_cell_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

lungcarcinoma; non_small_cell_carcinoma

c.209+5G>A; p.?; 10:89675299-89675299

lungcarcinoma; small_cell_carcinoma

c.751G>T; p.G251C; 10:89707706-89707706

lungcarcinoma; non_small_cell_carcinoma

c.751G>T; p.G251C; 10:89707706-89707706

lungcarcinoma; squamous_cell_carcinoma

c.1_1212del1212; p.0?;

lungcarcinoma; adenocarcinoma

c.182A>G; p.H61R; 10:89675267-89675267

lungcarcinoma; small_cell_carcinoma

c.413A>G; p.Y138C; 10:89682909-89682909

lungcarcinoma; small_cell_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

lungcarcinoma; non_small_cell_carcinoma

c.1-?_492+?del; p.?;

lungcarcinoma; small_cell_carcinoma

c.1005_1006insA; p.R335fs*7; 10:89710834-89710835

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.384G>C; p.K128N;

prostatecarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

prostatecarcinoma

c.1_1212del1212; p.0?;

oesophaguscarcinoma; adenocarcinoma

c.821G>A; p.W274*; 10:89710650-89710650

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.821G>A; p.W274*; 10:89710650-89710650

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.496G>C; p.V166L; 10:89701858-89701858

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; Burkitt_lymphoma

c.165_1212del1048; p.R55fs*1; 10:89675250-89715209

prostatecarcinoma; adenocarcinoma

c.553C>G; p.H185D;

NSNS

c.530_531delAT; p.Y177fs*2; 10:89701892-89701893

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.700_701insCACGCTA; p.R234fs*3; 10:89707655-89707656

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.697_697C>GGGAGG; p.R233fs*25; 10:89707652-89707652

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

breastcarcinoma

c.79T>G; p.Y27D;

breastcarcinoma

c.744_745delTG; p.C250fs*2;

breastcarcinoma; ductal_carcinoma

c.49C>T; p.Q17*; 10:89614255-89614255

breastcarcinoma; ductal_carcinoma

c.492+2insGCCG; p.?; 10:89682990-89682991

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.635-2A>C; p.?; 10:89707588-89707588

central_nervous_system; thalamusglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

prostatecarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

prostatecarcinoma

c.385G>C; p.G129R;

prostatecarcinoma

c.1008C>G; p.Y336*; 10:89710837-89710837

prostatecarcinoma

c.493-1G>A; p.?; 10:89701854-89701854

prostatecarcinoma

c.464A>G; p.Y155C; 10:89682960-89682960

biliary_tract; bile_ductcarcinoma; adenocarcinoma

c.?; p.R173C;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_leukaemia

c.511C>T; p.Q171*; 10:89701873-89701873

livercarcinoma

c.883_884insT; p.C296fs*2;

livercarcinoma

c.204_205insA; p.N69fs*5;

livercarcinoma

c.215C>T; p.A72V;

livercarcinoma

c.?; p.M134I;

endometriumcarcinoma

c.?; p.R173H;

endometriumcarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; adenocarcinoma

c.477G>T; p.R159S; 10:89682973-89682973

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.705_706ins10; p.D236fs*10; 10:89707660-89707661

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.477G>T; p.R159S; 10:89682973-89682973

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.209+1delGTAA; p.?; 10:89675295-89675298

skinmalignant_melanoma

c.801+?del?; p.?;

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; Burkitt_lymphoma

c.495A>T; p.G165G;

lungcarcinoma; small_cell_carcinoma

c.494G>A; p.G165E; 10:89701856-89701856

lungcarcinoma; small_cell_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

lungcarcinoma; small_cell_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

soft_tissue; fibrous_tissue_and_uncertain_omalignant_fibrous_histiocytoma-pleomorphic_sarcoma

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1129_1132delTATA; p.Y377fs*35; 10:89715126-89715129

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.240A>T; p.K80N; 10:89680813-89680813

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.511C>T; p.Q171*; 10:89701873-89701873

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.741_742insA; p.P248fs*5; 10:89707696-89707697

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.640C>T; p.Q214*; 10:89707595-89707595

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1129_1132delTATA; p.Y377fs*35; 10:89715126-89715129

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.577_579delCTG; p.L193del; 10:89701939-89701941

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.287C>T; p.P96L; 10:89682783-89682783

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.394G>A; p.G132S; 10:89682890-89682890

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.376G>C; p.A126P; 10:89682872-89682872

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.389G>A; p.R130Q; 10:89682885-89682885

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.389G>A; p.R130Q; 10:89682885-89682885

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainprimitive_neuroectodermal_tumour-medulloblastoma

c.406_407insA; p.C136fs*1; 10:89682902-89682903

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1008C>G; p.Y336*; 10:89710837-89710837

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.675T>G; p.Y225*; 10:89707630-89707630

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493G>A; p.G165R; 10:89701855-89701855

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.227_228delAT; p.Y76fs*1; 10:89680800-89680801

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.385G>A; p.G129R; 10:89682881-89682881

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1011_1014delTTCT; p.F337fs*6; 10:89710840-89710843

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.319G>T; p.D107Y; 10:89682815-89682815

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1034T>A; p.L345Q; 10:89715031-89715031

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.361G>C; p.A121P; 10:89682857-89682857

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1154_1155delCT; p.S385fs*1; 10:89715151-89715152

breastcarcinoma

c.884_885insT; p.L295fs*3; 10:89710713-89710714

thyroidcarcinoma; papillary_carcinoma

c.573_583del11; p.V191fs*7; 10:89701935-89701945

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.594_596delGAT; p.M199del; 10:89701956-89701958

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.210_253del44; p.L70fs*7; 10:89680783-89680826

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1026_1027ins225; p.K342_V343ins75;

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.801_802ins309; p.K267_D268ins103;

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.210_253del44; p.L70fs*7; 10:89680783-89680826

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1004_1007delGATA; p.R335fs*8; 10:89710833-89710836

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.404delT; p.I135fs*12; 10:89682900-89682900

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.49C>T; p.Q17*; 10:89614255-89614255

endometriumcarcinoma; endometrioid_carcinoma

c.71_72insC; p.D24fs*19; 10:89614277-89614278

endometriumcarcinoma; endometrioid_carcinoma

c.165-1G>T; p.?; 10:89675249-89675249

endometriumcarcinoma; endometrioid_carcinoma

c.227_228delAT; p.Y76fs*1; 10:89680800-89680801

endometriumcarcinoma; endometrioid_carcinoma

c.492+2delT; p.?; 10:89682990-89682990

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.634+1G>T; p.?; 10:89701997-89701997

endometriumcarcinoma; endometrioid_carcinoma

c.703G>T; p.E235*; 10:89707658-89707658

endometriumcarcinoma; endometrioid_carcinoma

c.711_712insAA; p.K237fs*19; 10:89707666-89707667

endometriumcarcinoma; endometrioid_carcinoma

c.202_203delTA; p.Y68fs*5; 10:89675287-89675288

endometriumcarcinoma; endometrioid_carcinoma

c.202_203delTA; p.Y68fs*5; 10:89675287-89675288

ovarycarcinoma; endometrioid_carcinoma

c.425G>A; p.R142Q; 10:89682921-89682921

ovarycarcinoma; endometrioid_carcinoma

c.792_804del13; p.M264fs*8; 10:89707747-89710633

endometriumcarcinoma; endometrioid_carcinoma

c.792_804del13; p.M264fs*8; 10:89707747-89710633

ovarycarcinoma; endometrioid_carcinoma

c.646G>A; p.V216M; 10:89707601-89707601

endometriumcarcinoma; squamous_cell_carcinoma

c.992A>G; p.D331G; 10:89710821-89710821

endometriumcarcinoma; endometrioid_carcinoma

c.59G>A; p.G20E; 10:89614265-89614265

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.680C>T; p.S227F; 10:89707635-89707635

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.227_228delAT; p.Y76fs*1; 10:89680800-89680801

endometriumcarcinoma; serous_carcinoma

c.97delA; p.I33fs*21; 10:89643779-89643779

endometriumcarcinoma; serous_carcinoma

c.97delA; p.I33fs*21; 10:89643779-89643779

endometriumcarcinoma; serous_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.450G>T; p.E150D; 10:89682946-89682946

endometriumcarcinoma; endometrioid_carcinoma

c.54_57delGGAT; p.E18fs*5; 10:89614260-89614263

endometriumcarcinoma; adenocarcinoma

c.799_800delAA; p.K267fs*30; 10:89707754-89707755

endometriumcarcinoma; adenocarcinoma

c.89delC; p.P30fs*24; 10:89643771-89643771

endometriumcarcinoma; adenocarcinoma

c.96delT; p.I32fs*22; 10:89643778-89643778

endometriumcarcinoma; adenocarcinoma

c.97_100delATTG; p.I33fs*20; 10:89643779-89643782

endometriumcarcinoma; adenocarcinoma

c.296_297insTA; p.E99fs*15; 10:89682792-89682793

endometriumcarcinoma; adenocarcinoma

c.319G>T; p.D107Y; 10:89682815-89682815

endometriumcarcinoma; adenocarcinoma

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumcarcinoma; adenocarcinoma

c.356T>A; p.V119D; 10:89682852-89682852

endometriumcarcinoma; adenocarcinoma

c.382_390del9; p.K128_R130del; 10:89682878-89682886

endometriumcarcinoma; adenocarcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; adenocarcinoma

c.519C>T; p.R173R; 10:89701881-89701881

endometriumcarcinoma; adenocarcinoma

c.530_534delATTAT; p.Y177fs*1; 10:89701892-89701896

endometriumcarcinoma; adenocarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; adenocarcinoma

c.762_775del14; p.K254fs*39; 10:89707717-89707730

endometriumcarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; adenocarcinoma

c.956_959delCTTT; p.T319fs*24; 10:89710785-89710788

endometriumcarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; adenocarcinoma

c.967_968delAA; p.N323fs*1; 10:89710796-89710797

endometriumcarcinoma; adenocarcinoma

c.989_990delAA; p.K330fs*12; 10:89710818-89710819

endometriumcarcinoma; adenocarcinoma

c.473_474insT; p.V158fs*22; 10:89682969-89682970

prostatecarcinoma; adenocarcinoma

c.107delG; p.G36fs*18; 10:89643789-89643789

prostatecarcinoma; adenocarcinoma

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

prostatecarcinoma; adenocarcinoma

c.131_139GCGTATACA>ACAGAAAGACA; p.G44fs*11; 10:89643813-89643821

prostatecarcinoma; adenocarcinoma

c.493-12delT; p.?; 10:89701843-89701843

prostatecarcinoma; adenocarcinoma

c.80-?_634+?del; p.Y27_N212>Y;

lungcarcinoma; small_cell_carcinoma

c.202T>C; p.Y68H; 10:89675287-89675287

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493G>A; p.G165R; 10:89701855-89701855

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.956_959delCTTT; p.T319fs*24; 10:89710785-89710788

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.165-2A>C; p.?; 10:89675248-89675248

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.172G>T; p.D58Y; 10:89675257-89675257

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.509G>T; p.S170I; 10:89701871-89701871

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.951_954delACTT; p.V317fs*3; 10:89710780-89710783

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.385G>A; p.G129R; 10:89682881-89682881

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumhyperplasia

c.382_395del14; p.K128fs*47; 10:89682878-89682891

endometriumhyperplasia

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumhyperplasia

c.388C>T; p.R130*; 10:89682884-89682884

endometriumhyperplasia

c.389_395delGAACTGG; p.R130fs*2; 10:89682885-89682891

endometriumhyperplasia

c.389G>T; p.R130L; 10:89682885-89682885

endometriumhyperplasia

c.415_416delTT; p.L139fs*40; 10:89682911-89682912

endometriumhyperplasia

c.416T>G; p.L139*; 10:89682912-89682912

endometriumhyperplasia

c.517C>T; p.R173C; 10:89701879-89701879

endometriumhyperplasia

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumhyperplasia

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumhyperplasia

c.377C>T; p.A126V; 10:89682873-89682873

ovarycarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

ovarycarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

ovarycarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

ovarycarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

ovarycarcinoma; endometrioid_carcinoma

c.923delG; p.R308fs*9; 10:89710752-89710752

ovarycarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

ovarycarcinoma; mucinous_carcinoma

c.1-?_164+?del; p.M1_?del fs;

lungcarcinoma; small_cell_carcinoma

c.711delG; p.K237fs*19; 10:89707666-89707666

lungcarcinoma; small_cell_carcinoma

c.703G>T; p.E235*; 10:89707658-89707658

lungcarcinoma; squamous_cell_carcinoma

c.520T>A; p.Y174N; 10:89701882-89701882

prostatecarcinoma; adenocarcinoma

c.1106T>G; p.V369G; 10:89715103-89715103

prostatecarcinoma; adenocarcinoma

c.480C>T; p.T160T; 10:89682976-89682976

prostatecarcinoma; adenocarcinoma

c.47_48insA; p.Y16fs*1; 10:89614253-89614254

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.104T>G; p.M35R; 10:89643786-89643786

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.127delG; p.E43fs*11; 10:89643809-89643809

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.182A>G; p.H61R; 10:89675267-89675267

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.253+1G>A; p.?; 10:89680827-89680827

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.454C>G; p.L152V; 10:89682950-89682950

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.634+4A>G; p.?; 10:89702000-89702000

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.686C>G; p.S229*; 10:89707641-89707641

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1133_1136delGATA; p.R378fs*25; 10:89715130-89715133

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.175T>C; p.S59P; 10:89675260-89675260

breastcarcinoma; ductal_carcinoma

c.97_99delATT; p.I33del; 10:89643779-89643781

endometriumcarcinoma

c.275A>G; p.D92G; 10:89682771-89682771

endometriumcarcinoma; endometrioid_carcinoma

c.277C>T; p.H93Y; 10:89682773-89682773

endometriumcarcinoma

c.370T>A; p.C124S; 10:89682866-89682866

endometriumcarcinoma; endometrioid_carcinoma

c.397G>A; p.V133I; 10:89682893-89682893

endometriumcarcinoma; endometrioid_carcinoma

c.397G>A; p.V133I; 10:89682893-89682893

endometriumcarcinoma; endometrioid_carcinoma

c.509G>A; p.S170N; 10:89701871-89701871

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma

c.801+1G>T; p.?; 10:89707757-89707757

endometriumcarcinoma; endometrioid_carcinoma

c.892C>T; p.Q298*; 10:89710721-89710721

endometriumcarcinoma

c.730delC; p.P244fs*12; 10:89707685-89707685

prostatecarcinoma; adenocarcinoma

c.499A>C; p.T167P; 10:89701861-89701861

breastcarcinoma

c.431A>T; p.K144I; 10:89682927-89682927

livercarcinoma; hepatocellular_carcinoma

c.764T>C; p.V255A; 10:89707719-89707719

livercarcinoma; hepatocellular_carcinoma

c.209+6T>A; p.?; 10:89675300-89675300

livercarcinoma; hepatocellular_carcinoma

c.403_405delATA; p.I135del; 10:89682899-89682901

breastcarcinoma

c.182A>T; p.H61L; 10:89675267-89675267

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; Burkitt_lymphoma

c.1003C>T; p.R335*; 10:89710832-89710832

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; Burkitt_lymphoma

c.210-7delCTTT; p.?; 10:89680776-89680779

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; chronic_lymphocytic_leukaemia-small_lymphocytic_lymphoma

c.79+11C>T; p.?; 10:89614296-89614296

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; mantle_cell_lymphoma

c.1026+43G>A; p.?; 10:89710898-89710898

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; follicular_lymphoma

c.921G>A; p.E307E; 10:89710750-89710750

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm

c.69_74delAGACTT; p.D24_L25del; 10:89614275-89614280

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.182A>G; p.H61R; 10:89675267-89675267

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.195C>A; p.Y65*; 10:89675280-89675280

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.238A>G; p.K80E; 10:89680811-89680811

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.254-3C>A; p.?; 10:89682747-89682747

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.407G>T; p.C136F; 10:89682903-89682903

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.395G>T; p.G132V; 10:89682891-89682891

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.509G>A; p.S170N; 10:89701871-89701871

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.610C>T; p.P204S; 10:89701972-89701972

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.758T>A; p.I253N; 10:89707713-89707713

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1211G>T; p.*404L; 10:89715208-89715208

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.502A>T; p.I168F; 10:89701864-89701864

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.1054G>T; p.E352*; 10:89715051-89715051

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.40A>G; p.R14G; 10:89614246-89614246

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.209+30C>T; p.?; 10:89675324-89675324

central_nervous_system; brainglioma; astrocytoma_Grade_I

c.1026+24G>A; p.?; 10:89710879-89710879

central_nervous_system; brainglioma; astrocytoma_Grade_I

c.910T>A; p.C304S; 10:89710739-89710739

central_nervous_system; brainglioma; astrocytoma_Grade_I

c.493-12delT; p.?; 10:89701843-89701843

central_nervous_system; brainglioma; astrocytoma_Grade_I

c.1026+32G>T; p.?; 10:89710887-89710887

central_nervous_system; brainglioma; astrocytoma_Grade_I

c.466G>A; p.G156R; 10:89682962-89682962

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.41_42insG; p.R14fs*29; 10:89614247-89614248

endometriumcarcinoma; endometrioid_carcinoma

c.44G>T; p.R15I; 10:89614250-89614250

endometriumcarcinoma; endometrioid_carcinoma

c.19G>T; p.E7*; 10:89614225-89614225

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.44G>T; p.R15I; 10:89614250-89614250

endometriumcarcinoma; endometrioid_carcinoma

c.188delA; p.N63fs*36; 10:89675273-89675273

endometriumcarcinoma; endometrioid_carcinoma

c.188delA; p.N63fs*36; 10:89675273-89675273

endometriumhyperplasia; atypical

c.244_247delAATT; p.N82fs*16; 10:89680817-89680820

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.436T>G; p.L146V; 10:89682932-89682932

endometriumcarcinoma; endometrioid_carcinoma

c.391delA; p.T131fs*3; 10:89682887-89682887

endometriumcarcinoma; endometrioid_carcinoma

c.404_405insT; p.I135fs*45; 10:89682900-89682901

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.600_601insTT; p.F200fs*21; 10:89701962-89701963

endometriumcarcinoma; endometrioid_carcinoma

c.600_601insTT; p.F200fs*21; 10:89701962-89701963

endometriumhyperplasia; atypical

c.773delT; p.F258fs*8; 10:89707728-89707728

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.993delC; p.D331fs*13; 10:89710822-89710822

endometriumcarcinoma; endometrioid_carcinoma

c.1011_1014delTTCT; p.F337fs*6; 10:89710840-89710843

endometriumcarcinoma; endometrioid_carcinoma

c.859_868del10; p.S287fs*1; 10:89710688-89710697

endometriumcarcinoma; endometrioid_carcinoma

c.392C>T; p.T131I; 10:89682888-89682888

ovarycarcinoma; serous_carcinoma

c.182A>C; p.H61P; 10:89675267-89675267

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.365T>G; p.I122S; 10:89682861-89682861

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.206delA; p.N69fs*30; 10:89675291-89675291

endometriumcarcinoma; adenocarcinoma

c.271G>T; p.E91*; 10:89682767-89682767

endometriumcarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; adenocarcinoma

c.518G>A; p.R173H; 10:89701880-89701880

endometriumcarcinoma; adenocarcinoma

c.196A>G; p.K66E; 10:89675281-89675281

endometriumcarcinoma; adenocarcinoma

c.218A>T; p.E73V; 10:89680791-89680791

endometriumcarcinoma; adenocarcinoma

c.284C>T; p.P95L; 10:89682780-89682780

endometriumcarcinoma; adenocarcinoma

c.165_209del45; p.R55_L70>S; 10:89675250-89675294

endometriumcarcinoma; adenocarcinoma

c.803delA; p.D268fs*8; 10:89710632-89710632

endometriumcarcinoma; adenocarcinoma

c.348_349insG; p.D116fs*9; 10:89682844-89682845

endometriumcarcinoma; adenocarcinoma

c.213_256del44; p.C71fs*6; 10:89680786-89682752

endometriumcarcinoma; adenocarcinoma

c.962_965delCAAA; p.T321fs*22; 10:89710791-89710794

endometriumcarcinoma; adenocarcinoma

c.335T>C; p.L112P; 10:89682831-89682831

endometriumcarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; adenocarcinoma

c.827delA; p.N276fs*15; 10:89710656-89710656

endometriumcarcinoma; adenocarcinoma

c.813delT; p.F271fs*5; 10:89710642-89710642

endometriumcarcinoma; adenocarcinoma

c.275A>T; p.D92V; 10:89682771-89682771

endometriumcarcinoma; adenocarcinoma

c.71A>G; p.D24G; 10:89614277-89614277

endometriumcarcinoma; adenocarcinoma

c.209T>C; p.L70P; 10:89675294-89675294

endometriumcarcinoma; adenocarcinoma

c.517C>T; p.R173C; 10:89701879-89701879

cervixcarcinoma; squamous_cell_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

cervixcarcinoma; squamous_cell_carcinoma

c.546A>T; p.L182F; 10:89701908-89701908

pancreascarcinoid-endocrine_tumour; non_functioning

c.1026G>C; p.K342N; 10:89710855-89710855

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; diffuse_large_B_cell_lymphoma

c.29G>A; p.S10N; 10:89614235-89614235

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; diffuse_large_B_cell_lymphoma

c.98T>G; p.I33S; 10:89643780-89643780

endometriumcarcinoma

c.96delT; p.I32fs*22; 10:89643778-89643778

endometriumcarcinoma

c.253+1G>A; p.?; 10:89680827-89680827

endometriumcarcinoma

c.277C>T; p.H93Y; 10:89682773-89682773

endometriumcarcinoma

c.738delG; p.P246fs*10; 10:89707693-89707693

endometriumcarcinoma

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

endometriumcarcinoma

c.963_964insA; p.T321fs*3; 10:89710792-89710793

endometriumcarcinoma

c.1008C>A; p.Y336*; 10:89710837-89710837

endometriumcarcinoma

c.94_96delATT; p.I32del; 10:89643776-89643778

endometriumcarcinoma

c.976_1026+4del55; p.D326_K342del; 10:89710805-89710859

endometriumcarcinoma

c.253+1G>A; p.?; 10:89680827-89680827

endometriumcarcinoma

c.405_406insA; p.I135fs*44; 10:89682901-89682902

endometriumcarcinoma

c.654C>A; p.C218*; 10:89707609-89707609

endometriumcarcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma

c.750T>A; p.C250*; 10:89707705-89707705

endometriumcarcinoma

c.640C>T; p.Q214*; 10:89707595-89707595

endometriumcarcinoma

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

endometriumcarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

endometriumcarcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

endometriumcarcinoma

c.963_964insA; p.T321fs*3; 10:89710792-89710793

endometriumcarcinoma

c.963_964insA; p.T321fs*3; 10:89710792-89710793

endometriumcarcinoma

c.877G>T; p.G293*; 10:89710706-89710706

endometriumcarcinoma

c.963_964insA; p.T321fs*3; 10:89710792-89710793

stomachcarcinoma; adenocarcinoma

c.332G>A; p.W111*; 10:89682828-89682828

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.263A>C; p.Y88S; 10:89682759-89682759

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.50A>C; p.Q17P; 10:89614256-89614256

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.320A>C; p.D107A; 10:89682816-89682816

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.822G>A; p.W274*; 10:89710651-89710651

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.822G>A; p.W274*; 10:89710651-89710651

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.142A>G; p.N48D; 10:89643824-89643824

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.492+2delT; p.?; 10:89682990-89682990

livercarcinoma; hepatocellular_carcinoma

c.492+2delT; p.?; 10:89682990-89682990

livercarcinoma; hepatocellular_carcinoma

c.247_248insT; p.C83fs*9; 10:89680820-89680821

livercarcinoma; hepatocellular_carcinoma

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

livercarcinoma; hepatocellular_carcinoma

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

livercarcinoma; hepatocellular_carcinoma

c.69A>C; p.L23F; 10:89614275-89614275

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.279T>G; p.H93Q; 10:89682775-89682775

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.302T>C; p.I101T; 10:89682798-89682798

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.364_368delATTCA; p.I122fs*2; 10:89682860-89682864

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.370delT; p.C124fs*10; 10:89682866-89682866

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.376G>A; p.A126T; 10:89682872-89682872

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.404T>A; p.I135K; 10:89682900-89682900

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.509G>T; p.S170I; 10:89701871-89701871

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.512A>C; p.Q171P; 10:89701874-89701874

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517delC; p.R173fs*10; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.551A>T; p.N184I; 10:89701913-89701913

central_nervous_system; brainglioma; oligoastrocytoma_Grade_IV

c.632G>A; p.C211Y; 10:89701994-89701994

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.737C>T; p.P246L; 10:89707692-89707692

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.754G>T; p.D252Y; 10:89707709-89707709

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.760_764delAAAGT; p.K254fs*42; 10:89707715-89707719

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1121delC; p.P374fs*30; 10:89715118-89715118

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.226_228delTAT; p.Y76del; 10:89680799-89680801

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.392C>A; p.T131N; 10:89682888-89682888

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.209+5G>A; p.?; 10:89675299-89675299

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.80A>C; p.Y27S; 10:89643762-89643762

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.511C>T; p.Q171*; 10:89701873-89701873

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.125T>C; p.L42P; 10:89643807-89643807

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.987_996del10; p.N329fs*12; 10:89710816-89710825

breastcarcinoma; ductal_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

breastcarcinoma; ductal_carcinoma

c.635-1G>T; p.?; 10:89707589-89707589

endometriumcarcinoma

c.640C>T; p.Q214*; 10:89707595-89707595

endometriumcarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma

c.548_549insA; p.N184fs*6; 10:89701910-89701911

endometriumcarcinoma

c.499A>G; p.T167A; 10:89701861-89701861

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.437_438insT; p.L146fs*34; 10:89682933-89682934

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.415_416delTT; p.L139fs*40; 10:89682911-89682912

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>A; p.C105Y; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.1013_1023del11; p.S338fs*1; 10:89710842-89710852

breastcarcinoma

c.733C>T; p.Q245*; 10:89707688-89707688

lungcarcinoma; non_small_cell_carcinoma

c.634+3A>T; p.?; 10:89701999-89701999

endometriumcarcinoma

c.802-29T>C; p.?; 10:89710602-89710602

oesophaguscarcinoma; squamous_cell_carcinoma

c.421C>T; p.H141Y; 10:89682917-89682917

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.125T>G; p.L42R; 10:89643807-89643807

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.232A>G; p.T78A; 10:89680805-89680805

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.125T>G; p.L42R; 10:89643807-89643807

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.274G>A; p.D92N; 10:89682770-89682770

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.125T>G; p.L42R; 10:89643807-89643807

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.125T>G; p.L42R; 10:89643807-89643807

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.592_594delATG; p.M198del; 10:89701954-89701956

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.45_46insT; p.R15fs*28; 10:89614251-89614252

endometriumcarcinoma; endometrioid_carcinoma

c.242T>G; p.F81C; 10:89680815-89680815

endometriumcarcinoma; endometrioid_carcinoma

c.309_319del11; p.P103fs*3; 10:89682805-89682815

endometriumhyperplasia; typical

c.392_411del20; p.T131fs*42; 10:89682888-89682907

endometriumhyperplasia; complex-atypical

c.537_540delCTAC; p.S179fs*3; 10:89701899-89701902

endometriumhyperplasia; complex-atypical

c.445C>T; p.Q149*; 10:89682941-89682941

endometriumhyperplasia; complex-atypical

c.459T>C; p.D153D; 10:89682955-89682955

endometriumcarcinoma; endometrioid_carcinoma

c.485_486insCAAAAAGG; p.D162fs*8; 10:89682981-89682982

endometriumhyperplasia; complex-atypical

c.667delA; p.K223fs*33; 10:89707622-89707622

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumhyperplasia; complex-atypical

c.697C>T; p.R233*; 10:89707652-89707652

endometriumhyperplasia; complex-atypical

c.697C>T; p.R233*; 10:89707652-89707652

endometriumhyperplasia; complex-atypical

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; squamous_cell_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.800_801insA; p.K267fs*31; 10:89707755-89707756

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.850G>A; p.E284K; 10:89710679-89710679

endometriumcarcinoma; endometrioid_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.492+65G>T; p.?; 10:89683053-89683053

endometriumcarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma

c.388C>A; p.R130R; 10:89682884-89682884

endometriumcarcinoma

c.867delA; p.V290fs*1; 10:89710696-89710696

endometriumcarcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma

c.75_78delGACC; p.L25fs*28; 10:89614281-89614284

endometriumcarcinoma

c.1026+60delA; p.?; 10:89710915-89710915

endometriumcarcinoma

c.9_30del22; p.A3fs*14; 10:89614215-89614236

endometriumcarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma

c.492+67T>A; p.?; 10:89683055-89683055

endometriumcarcinoma

c.740_744delTACCT; p.L247fs*4; 10:89707695-89707699

endometriumcarcinoma

c.295G>T; p.E99*; 10:89682791-89682791

endometriumcarcinoma

c.496_511>CAGTT; p.V166fs*10; 10:89701858-89701873

endometriumcarcinoma

c.635delA; p.N212fs*9; 10:89707590-89707590

endometriumcarcinoma

c.1038C>A; p.Y346*; 10:89715035-89715035

endometriumcarcinoma

c.494G>A; p.G165E; 10:89701856-89701856

central_nervous_system; brainglioma; oligodendroglioma_Grade_III

c.955_956insT; p.T319fs*6; 10:89710784-89710785

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.303_304ins38; p.I101fs*10; 10:89682799-89682800

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.380_386delGAAAGGG; p.G127fs*5; 10:89682876-89682882

cervixcarcinoma; squamous_cell_carcinoma

c.37A>C; p.K13Q; 10:89614243-89614243

endometriumcarcinoma

c.196A>C; p.K66Q; 10:89675281-89675281

endometriumcarcinoma

c.212G>A; p.C71Y; 10:89680785-89680785

endometriumcarcinoma

c.280A>T; p.N94Y; 10:89682776-89682776

endometriumcarcinoma

c.338_341delGTGA; p.S113fs*20; 10:89682834-89682837

endometriumcarcinoma

c.396delT; p.G132fs*2; 10:89682892-89682892

endometriumcarcinoma

c.463T>C; p.Y155H; 10:89682959-89682959

endometriumcarcinoma

c.536G>T; p.S179I; 10:89701898-89701898

endometriumcarcinoma

c.564T>G; p.Y188*; 10:89701926-89701926

endometriumcarcinoma

c.592delA; p.M198fs*1; 10:89701954-89701954

endometriumcarcinoma

c.193T>A; p.Y65N; 10:89675278-89675278

endometriumcarcinoma

c.728delT; p.F243fs*13; 10:89707683-89707683

endometriumcarcinoma

c.954delT; p.L318fs*3; 10:89710783-89710783

endometriumcarcinoma

c.103A>G; p.M35V; 10:89643785-89643785

livercarcinoma; hepatocellular_carcinoma

c.750_751delTG; p.C250fs*2; 10:89707705-89707706

endometriumhyperplasia; atypical

c.860_867delCAGAAAAA; p.S287fs*8; 10:89710689-89710696

endometriumhyperplasia; atypical

c.154_156delGAT; p.D52del; 10:89643836-89643838

endometriumhyperplasia; atypical

c.154_156delGAT; p.D52del; 10:89643836-89643838

endometriumcarcinoma; adenocarcinoma

c.155A>G; p.D52G; 10:89643837-89643837

endometriumcarcinoma; adenocarcinoma

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

endometriumcarcinoma; adenocarcinoma

c.110T>C; p.F37S; 10:89643792-89643792

vulvain_situ_neoplasm; vulvar_intraepithelial_neoplasia_Grade_I

c.210-48delCCTAA; p.?; 10:89680735-89680739

vulvain_situ_neoplasm; vulvar_intraepithelial_neoplasia_Grade_I

c.110T>C; p.F37S; 10:89643792-89643792

vulvacarcinoma; squamous_cell_carcinoma

c.210-48delCCTAA; p.?; 10:89680735-89680739

vulvacarcinoma; squamous_cell_carcinoma

c.17A>G; p.K6R; 10:89614223-89614223

vulvain_situ_neoplasm; vulvar_intraepithelial_neoplasia_Grade_III

c.862G>A; p.E288K; 10:89710691-89710691

vulvain_situ_neoplasm; vulvar_intraepithelial_neoplasia_Grade_III

c.40A>G; p.R14G; 10:89614246-89614246

vulvain_situ_neoplasm; vulvar_intraepithelial_neoplasia_Grade_III

c.131G>A; p.G44D; 10:89643813-89643813

vulvain_situ_neoplasm; vulvar_intraepithelial_neoplasia_Grade_III

c.250A>G; p.R84G; 10:89680823-89680823

vulvacarcinoma; squamous_cell_carcinoma

c.750_751delTG; p.C250fs*2; 10:89707705-89707706

vulvacarcinoma; squamous_cell_carcinoma

c.700C>T; p.R234W; 10:89707655-89707655

vulvacarcinoma; squamous_cell_carcinoma

c.750_751delTG; p.C250fs*2; 10:89707705-89707706

vulvain_situ_neoplasm; vulvar_intraepithelial_neoplasia_Grade_III

c.968delA; p.N323fs*21; 10:89710797-89710797

vulvacarcinoma; squamous_cell_carcinoma

c.165-2insA; p.?; 10:89675248-89675249

vulvacarcinoma; squamous_cell_carcinoma

c.165-8insT; p.?; 10:89675242-89675243

vulvacarcinoma; squamous_cell_carcinoma

c.165-16T>C; p.?; 10:89675234-89675234

vulvacarcinoma; squamous_cell_carcinoma

c.165-5insT; p.?; 10:89675245-89675246

vulvacarcinoma; squamous_cell_carcinoma

c.1093G>A; p.V365I; 10:89715090-89715090

cervixcarcinoma; adenocarcinoma

c.46_65del20; p.Y16fs*21; 10:89614252-89614271

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.940G>T; p.E314*; 10:89710769-89710769

endometriumcarcinoma; endometrioid_carcinoma

c.321_326delTCTTGA; p.L108_D109del; 10:89682817-89682822

endometriumcarcinoma; endometrioid_carcinoma

c.335T>C; p.L112P; 10:89682831-89682831

endometriumcarcinoma; endometrioid_carcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.864delA; p.E288fs*3; 10:89710693-89710693

endometriumcarcinoma; endometrioid_carcinoma

c.151_153delGAT; p.D51del; 10:89643833-89643835

endometriumcarcinoma; endometrioid_carcinoma

c.319G>T; p.D107Y; 10:89682815-89682815

endometriumcarcinoma; endometrioid_carcinoma

c.897_915del19; p.E299fs*2; 10:89710726-89710744

endometriumcarcinoma; endometrioid_carcinoma

c.209+2delTAAGTATGTTTTCTTATTTGTATGCTTG; p.?; 10:89675296-89675323

endometriumcarcinoma; endometrioid_carcinoma

c.492+2delT; p.?; 10:89682990-89682990

endometriumcarcinoma; endometrioid_carcinoma

c.703G>T; p.E235*; 10:89707658-89707658

endometriumcarcinoma; endometrioid_carcinoma

c.165-1G>T; p.?; 10:89675249-89675249

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.49C>T; p.Q17*; 10:89614255-89614255

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.492+1G>T; p.?; 10:89682989-89682989

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.71_72insC; p.D24fs*19; 10:89614277-89614278

endometriumcarcinoma; endometrioid_carcinoma

c.711_712insAA; p.K237fs*19; 10:89707666-89707667

endometriumcarcinoma; endometrioid_carcinoma

c.953_956delTTAC; p.L318fs*2; 10:89710782-89710785

endometriumcarcinoma; endometrioid_carcinoma

c.78delC; p.T26fs*28; 10:89614284-89614284

endometriumcarcinoma; endometrioid_carcinoma

c.200T>G; p.I67R; 10:89675285-89675285

endometriumcarcinoma; endometrioid_carcinoma

c.594_596delGAT; p.M199del; 10:89701956-89701958

endometriumcarcinoma; endometrioid_carcinoma

c.1212A>C; p.*404C; 10:89715209-89715209

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.348delC; p.D116fs*18; 10:89682844-89682844

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.546_549delAAAG; p.L182fs*16; 10:89701908-89701911

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.506C>A; p.P169H; 10:89701868-89701868

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493G>A; p.G165R; 10:89701855-89701855

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.597delG; p.M199fs*22; 10:89701959-89701959

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.164_165ins45; p.R55_F56ins15;

skin; footmalignant_melanoma; acral_lentiginous

c.1002_1003CC>TT; p.R335*; 10:89710831-89710832

skin; footmalignant_melanoma; nodular

c.730C>T; p.P244S; 10:89707685-89707685

skin; shouldermalignant_melanoma; nodular

c.164_165ins45; p.R55_F56ins15;

skinmalignant_melanoma

c.1002_1003CC>TT; p.R335*; 10:89710831-89710832

skinmalignant_melanoma

c.843_850delAGGACCAG; p.P281fs*14; 10:89710672-89710679

skinmalignant_melanoma

c.633C>A; p.C211*; 10:89701995-89701995

skinmalignant_melanoma

c.55G>A; p.D19N; 10:89614261-89614261

skinmalignant_melanoma

c.649G>A; p.V217I; 10:89707604-89707604

skinmalignant_melanoma

c.79+13G>A; p.?; 10:89614298-89614298

skinmalignant_melanoma

c.165-13G>A; p.?; 10:89675237-89675237

skinmalignant_melanoma

c.154G>A; p.D52N; 10:89643836-89643836

skinmalignant_melanoma

c.417A>C; p.L139F; 10:89682913-89682913

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1040delT; p.F347fs*5; 10:89715037-89715037

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.781C>T; p.Q261*; 10:89707736-89707736

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.170T>G; p.L57W; 10:89675255-89675255

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.567_571delACCAG; p.R189fs*11; 10:89701929-89701933

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.313T>G; p.C105G; 10:89682809-89682809

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.138C>G; p.Y46*; 10:89643820-89643820

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.406T>C; p.C136R; 10:89682902-89682902

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.103A>G; p.M35V; 10:89643785-89643785

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.286C>T; p.P96S; 10:89682782-89682782

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.888delT; p.C296fs*11; 10:89710717-89710717

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.331T>C; p.W111R; 10:89682827-89682827

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.278A>G; p.H93R; 10:89682774-89682774

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1189C>T; p.H397Y; 10:89715186-89715186

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.509G>A; p.S170N; 10:89701871-89701871

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.424C>T; p.R142W; 10:89682920-89682920

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.563A>C; p.Y188S; 10:89701925-89701925

stomachcarcinoma; adenocarcinoma

c.371G>A; p.C124Y; 10:89682867-89682867

stomachcarcinoma; adenocarcinoma

c.228T>C; p.Y76Y; 10:89680801-89680801

stomachcarcinoma; adenocarcinoma

c.634+39T>G; p.?; 10:89702035-89702035

stomachcarcinoma; adenocarcinoma

c.610C>A; p.P204T; 10:89701972-89701972

stomachcarcinoma; adenocarcinoma

c.93C>T; p.N31N; 10:89643775-89643775

stomachcarcinoma; adenocarcinoma

c.135A>G; p.V45V; 10:89643817-89643817

stomachcarcinoma; adenocarcinoma

c.135A>G; p.V45V; 10:89643817-89643817

stomachcarcinoma; adenocarcinoma

c.102T>G; p.A34A; 10:89643784-89643784

stomachcarcinoma; adenocarcinoma

c.245A>C; p.N82T; 10:89680818-89680818

stomachcarcinoma; adenocarcinoma

c.185A>T; p.K62I; 10:89675270-89675270

stomachcarcinoma; adenocarcinoma

c.245A>C; p.N82T; 10:89680818-89680818

stomachcarcinoma; adenocarcinoma

c.610C>A; p.P204T; 10:89701972-89701972

stomachcarcinoma; adenocarcinoma

c.200T>A; p.I67K; 10:89675285-89675285

stomachcarcinoma; adenocarcinoma

c.223_234del12; p.H75_T78del; 10:89680796-89680807

stomachcarcinoma; adenocarcinoma

c.1202C>T; p.T401I; 10:89715199-89715199

soft_tissue; smooth_muscleleiomyosarcoma

c.1027-7T>C; p.?; 10:89715017-89715017

soft_tissue; smooth_muscleleiomyosarcoma

c.405_406insA; p.I135fs*44; 10:89682901-89682902

bone; extraskeletalchondrosarcoma; myxoid

c.522T>G; p.Y174*; 10:89701884-89701884

bone; extraskeletalchondrosarcoma; myxoid

c.325_326insG; p.D109fs*6; 10:89682821-89682822

central_nervous_system; brainglioma; gliosarcoma

c.389G>A; p.R130Q; 10:89682885-89682885

central_nervous_system; brainglioma; gliosarcoma

c.198G>T; p.K66N; 10:89675283-89675283

central_nervous_system; brainglioma; gliosarcoma

c.42_52del11; p.R14fs*26; 10:89614248-89614258

central_nervous_system; brainglioma; gliosarcoma

c.227_228delAT; p.Y76fs*1; 10:89680800-89680801

central_nervous_system; brainglioma; gliosarcoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

central_nervous_system; brainglioma; gliosarcoma

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; gliosarcoma

c.565A>T; p.R189*; 10:89701927-89701927

central_nervous_system; brainglioma; gliosarcoma

c.395G>A; p.G132D; 10:89682891-89682891

central_nervous_system; brainglioma; gliosarcoma

c.595_597delATG; p.M199del; 10:89701957-89701959

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.49_51delCAA; p.Q17del; 10:89614255-89614257

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.755A>G; p.D252G; 10:89707710-89707710

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.301_303delATC; p.I101del; 10:89682797-89682799

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.595_597delATG; p.M199del; 10:89701957-89701959

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.802-7delTTTTT; p.?; 10:89710624-89710628

stomachcarcinoma; adenocarcinoma

c.1123G>A; p.D375N; 10:89715120-89715120

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1202C>T; p.T401I; 10:89715199-89715199

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.13A>C; p.I5L; 10:89614219-89614219

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.508A>G; p.S170G; 10:89701870-89701870

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.384G>T; p.K128N; 10:89682880-89682880

central_nervous_system; brainglioma; oligodendroglioma

c.590delA; p.K197fs*2; 10:89701952-89701952

breastcarcinoma; lobular_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

soft_tissue; smooth_muscleleiomyosarcoma

c.44G>A; p.R15K; 10:89614250-89614250

soft_tissue; smooth_muscleleiomyosarcoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; carcinosarcoma-malignant_mesodermal_mixed_tumour

c.106G>T; p.G36*; 10:89643788-89643788

endometriumcarcinoma; mixed_adenosquamous_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; squamous_cell_carcinoma

c.895G>T; p.E299*; 10:89710724-89710724

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumcarcinoma; mixed_adenosquamous_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; mixed_adenosquamous_carcinoma

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumcarcinoma; endometrioid_carcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

endometriumcarcinoma; endometrioid_carcinoma

c.202T>C; p.Y68H; 10:89675287-89675287

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.867delA; p.V290fs*1; 10:89710696-89710696

endometriumcarcinoma; endometrioid_carcinoma

c.940_941insG; p.E314fs*11; 10:89710769-89710770

endometriumcarcinoma; endometrioid_carcinoma

c.886_887insA; p.C296fs*1; 10:89710715-89710716

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumcarcinoma; mixed_adenosquamous_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.405_423del19; p.I135fs*6; 10:89682901-89682919

endometriumcarcinoma; endometrioid_carcinoma

c.37A>G; p.K13E; 10:89614243-89614243

endometriumcarcinoma; endometrioid_carcinoma

c.76A>C; p.T26P; 10:89614282-89614282

endometriumcarcinoma; endometrioid_carcinoma

c.1021T>G; p.F341V; 10:89710850-89710850

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.176C>A; p.S59*; 10:89675261-89675261

endometriumcarcinoma; endometrioid_carcinoma

c.165_181del17; p.R55fs*2; 10:89675250-89675266

endometriumcarcinoma; endometrioid_carcinoma

c.1004_1014del11; p.R335fs*4; 10:89710833-89710843

endometriumcarcinoma; endometrioid_carcinoma

c.491_492insA; p.K164fs*16; 10:89682987-89682988

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumcarcinoma; endometrioid_carcinoma

c.800_801insA; p.K267fs*31; 10:89707755-89707756

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; mixed_endometrioid_and_clear_cell_carcinoma

c.559delG; p.D187fs*12; 10:89701921-89701921

endometriumcarcinoma; mixed_endometrioid_and_clear_cell_carcinoma

c.750_751delTG; p.C250fs*2; 10:89707705-89707706

endometriumcarcinoma; endometrioid_carcinoma

c.170_171insT; p.L57fs*6; 10:89675255-89675256

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; mixed_serous_and_endometrioid_and_clear_cell_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; mixed_serous_and_endometrioid_and_clear_cell_carcinoma

c.952_955delCTTA; p.L318fs*2; 10:89710781-89710784

endometriumcarcinoma; endometrioid_carcinoma

c.190_191delCA; p.H64fs*9; 10:89675275-89675276

endometriumcarcinoma; endometrioid_carcinoma

c.820delT; p.W274fs*2; 10:89710649-89710649

endometriumcarcinoma; endometrioid_carcinoma

c.632_633insG; p.C211fs*32; 10:89701994-89701995

endometriumcarcinoma; endometrioid_carcinoma

c.640C>T; p.Q214*; 10:89707595-89707595

endometriumcarcinoma; endometrioid_carcinoma

c.1012T>A; p.S338T; 10:89710841-89710841

endometriumcarcinoma; endometrioid_carcinoma

c.1009delT; p.F337fs*7; 10:89710838-89710838

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.1-9C>G; p.?; 10:89614198-89614198

cervixcarcinoma

c.1-9C>G; p.?; 10:89614198-89614198

cervixcarcinoma

c.802-3insT; p.?; 10:89710628-89710629

cervixcarcinoma

c.424C>T; p.R142W; 10:89682920-89682920

cervixcarcinoma

c.1-9C>G; p.?; 10:89614198-89614198

cervixcarcinoma

c.802-3delT; p.?; 10:89710628-89710628

cervixcarcinoma

c.802-3delT; p.?; 10:89710628-89710628

cervixcarcinoma

c.1-9C>G; p.?; 10:89614198-89614198

cervixcarcinoma

c.17_18delAA; p.K6fs*4; 10:89614223-89614224

central_nervous_system; brainglioma; oligodendroglioma_Grade_III

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

central_nervous_system; brainglioma; oligodendroglioma_Grade_III

c.170T>C; p.L57S; 10:89675255-89675255

central_nervous_system; brainglioma; oligodendroglioma_Grade_III

c.209+1G>C; p.?; 10:89675295-89675295

central_nervous_system; brainglioma; oligodendroglioma_Grade_III

c.977A>G; p.D326G; 10:89710806-89710806

central_nervous_system; brainglioma; oligodendroglioma_Grade_III

c.302T>C; p.I101T; 10:89682798-89682798

central_nervous_system; brainglioma; oligodendroglioma_Grade_III

c.166T>G; p.F56V; 10:89675251-89675251

ovarycarcinoma

c.70G>T; p.D24Y; 10:89614276-89614276

ovarycarcinoma

c.741_742insA; p.P248fs*5; 10:89707696-89707697

ovarycarcinoma

c.463T>A; p.Y155N; 10:89682959-89682959

ovarycarcinoma

c.469_470insG; p.E157fs*23; 10:89682965-89682966

ovarycarcinoma

c.862G>T; p.E288*; 10:89710691-89710691

ovarycarcinoma

c.163A>G; p.R55G; 10:89643845-89643845

prostatecarcinoma; adenocarcinoma

c.403A>G; p.I135V; 10:89682899-89682899

prostatecarcinoma; adenocarcinoma

c.302T>A; p.I101N; 10:89682798-89682798

prostatecarcinoma; adenocarcinoma

c.449A>G; p.E150G; 10:89682945-89682945

prostatecarcinoma; adenocarcinoma

c.58G>T; p.G20*; 10:89614264-89614264

prostatecarcinoma; adenocarcinoma

c.814C>T; p.H272Y; 10:89710643-89710643

prostatecarcinoma; adenocarcinoma

c.1031A>G; p.K344R; 10:89715028-89715028

prostatecarcinoma; adenocarcinoma

c.1043C>T; p.T348I; 10:89715040-89715040

prostatecarcinoma; adenocarcinoma

c.1144A>T; p.T382S; 10:89715141-89715141

prostatecarcinoma; adenocarcinoma

c.328C>T; p.Q110*; 10:89682824-89682824

prostatecarcinoma; adenocarcinoma

c.439A>T; p.K147*; 10:89682935-89682935

skincarcinoma; Merkel_cell_carcinoma

c.158T>G; p.V53G; 10:89643840-89643840

kidneycarcinoma; papillary_renal_cell_carcinoma

c.303C>G; p.I101M; 10:89682799-89682799

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.209+5G>A; p.?; 10:89675299-89675299

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.202T>C; p.Y68H; 10:89675287-89675287

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestine; rectumcarcinoma; adenocarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

large_intestine; caecumcarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestine; caecumcarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestine; coloncarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestine; coloncarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestine; coloncarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestine; coloncarcinoma; adenocarcinoma

c.410C>T; p.A137V; 10:89682906-89682906

upper_aerodigestive_tract; mouthcarcinoma; squamous_cell_carcinoma

c.760A>G; p.K254E; 10:89707715-89707715

salivary_glandcarcinoma; mucoepidermoid_carcinoma

c.756T>C; p.D252D; 10:89707711-89707711

salivary_glandcarcinoma; mucoepidermoid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

upper_aerodigestive_tract; mouthcarcinoma; squamous_cell_carcinoma

c.665T>C; p.V222A; 10:89707620-89707620

salivary_glandcarcinoma; adenocarcinoma

c.688G>A; p.G230R; 10:89707643-89707643

salivary_glandcarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

ovarycarcinoma; serous_carcinoma

c.518G>A; p.R173H; 10:89701880-89701880

ovarycarcinoma; serous_carcinoma

c.504delT; p.I168fs*15; 10:89701866-89701866

ovarycarcinoma; mucinous_carcinoma

c.978_979insC; p.D326fs*4; 10:89710807-89710808

ovarycarcinoma; endometrioid_carcinoma

c.462C>T; p.F154F; 10:89682958-89682958

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.771C>A; p.F257L; 10:89707726-89707726

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.35_53del19; p.N12fs*6; 10:89614241-89614259

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.47A>G; p.Y16C; 10:89614253-89614253

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.71A>G; p.D24G; 10:89614277-89614277

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.72C>G; p.D24E; 10:89614278-89614278

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.72C>G; p.D24E; 10:89614278-89614278

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.80A>G; p.Y27C; 10:89643762-89643762

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.94_96delATT; p.I32del; 10:89643776-89643778

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.94_96delATT; p.I32del; 10:89643776-89643778

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.106G>A; p.G36R; 10:89643788-89643788

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.107G>T; p.G36V; 10:89643789-89643789

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.107G>T; p.G36V; 10:89643789-89643789

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.165-9T>A; p.?; 10:89675241-89675241

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.165-9T>A; p.?; 10:89675241-89675241

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.165-1G>A; p.?; 10:89675249-89675249

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.193T>G; p.Y65D; 10:89675278-89675278

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.195C>G; p.Y65*; 10:89675280-89675280

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.199_201delATA; p.I67del; 10:89675284-89675286

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.202T>C; p.Y68H; 10:89675287-89675287

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.202T>C; p.Y68H; 10:89675287-89675287

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.209+1delGT; p.?; 10:89675295-89675296

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.209+1delGT; p.?; 10:89675295-89675296

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.209+5G>A; p.?; 10:89675299-89675299

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.226_227delTA; p.Y76fs*1; 10:89680799-89680800

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.237delC; p.A79fs*20; 10:89680810-89680810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.339_340ins71; p.S113fs*9; 10:89682835-89682836

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.272A>C; p.E91A; 10:89682768-89682768

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.275A>C; p.D92A; 10:89682771-89682771

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.283C>T; p.P95S; 10:89682779-89682779

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.287C>A; p.P96Q; 10:89682783-89682783

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.330_331ins32; p.Q110fs*13; 10:89682826-89682827

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.302T>C; p.I101T; 10:89682798-89682798

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.302T>C; p.I101T; 10:89682798-89682798

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>A; p.C105Y; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314G>T; p.C105F; 10:89682810-89682810

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.328C>T; p.Q110*; 10:89682824-89682824

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.328C>T; p.Q110*; 10:89682824-89682824

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.334C>G; p.L112V; 10:89682830-89682830

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.334C>G; p.L112V; 10:89682830-89682830

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.348delC; p.D116fs*18; 10:89682844-89682844

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.357delT; p.V119fs*15; 10:89682853-89682853

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.357delT; p.V119fs*15; 10:89682853-89682853

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.442G>A; p.A148T; 10:89682938-89682938

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.442G>A; p.A148T; 10:89682938-89682938

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493-1G>A; p.?; 10:89701854-89701854

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493-1G>A; p.?; 10:89701854-89701854

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493_495delGGA; p.G165del; 10:89701855-89701857

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.494G>A; p.G165E; 10:89701856-89701856

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.511C>T; p.Q171*; 10:89701873-89701873

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.511C>T; p.Q171*; 10:89701873-89701873

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.511C>G; p.Q171E; 10:89701873-89701873

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.511C>G; p.Q171E; 10:89701873-89701873

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.546_549delAAAG; p.L182fs*16; 10:89701908-89701911

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.575delC; p.A192fs*7; 10:89701937-89701937

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.635-9A>G; p.?; 10:89707581-89707581

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.655C>T; p.Q219*; 10:89707610-89707610

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.737C>T; p.P246L; 10:89707692-89707692

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.737C>T; p.P246L; 10:89707692-89707692

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.741_742insA; p.P248fs*5; 10:89707696-89707697

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.741_742insA; p.P248fs*5; 10:89707696-89707697

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.741_742insA; p.P248fs*5; 10:89707696-89707697

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.751G>T; p.G251C; 10:89707706-89707706

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.751G>T; p.G251C; 10:89707706-89707706

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.756_757insT; p.D252fs*45; 10:89707711-89707712

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.820T>G; p.W274G; 10:89710649-89710649

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.821G>A; p.W274*; 10:89710650-89710650

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.881_885delGTCTA; p.S294fs*2; 10:89710710-89710714

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.881_885delGTCTA; p.S294fs*2; 10:89710710-89710714

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.954_957delTACT; p.L318fs*2; 10:89710783-89710786

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.955_956insA; p.T319fs*6; 10:89710784-89710785

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.968delA; p.N323fs*21; 10:89710797-89710797

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.987_990delTAAA; p.N329fs*14; 10:89710816-89710819

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1211G>C; p.*404S; 10:89715208-89715208

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.281A>T; p.N94I; 10:89682777-89682777

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.362C>A; p.A121E; 10:89682858-89682858

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.674A>G; p.Y225C; 10:89707629-89707629

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.992A>G; p.D331G; 10:89710821-89710821

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.165-11T>G; p.?; 10:89675239-89675239

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.270T>A; p.F90L; 10:89682766-89682766

upper_aerodigestive_tract; pharynxcarcinoma; squamous_cell_carcinoma

c.615G>A; p.M205I; 10:89701977-89701977

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.492+99G>A; p.?; 10:89683087-89683087

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.275A>G; p.D92G; 10:89682771-89682771

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.362C>A; p.A121E; 10:89682858-89682858

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.79+25C>A; p.?; 10:89614310-89614310

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.992A>G; p.D331G; 10:89710821-89710821

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.263A>G; p.Y88C; 10:89682759-89682759

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.1-156C>T; p.?; 10:89614051-89614051

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.801+25A>C; p.?; 10:89707781-89707781

upper_aerodigestive_tract; larynxcarcinoma; squamous_cell_carcinoma

c.1-225G>A; p.?; 10:89613982-89613982

upper_aerodigestive_tract; head_neckcarcinoma; squamous_cell_carcinoma

c.1_8delATGACAGC; p.M1fs*7; 10:89614204-89614214

haematopoietic_and_lymphoid_tissue; adrenal_glandlymphoid_neoplasm; diffuse_large_B_cell_lymphoma

c.489_497AAAGGGAGT>TAAGGGAGA; p.K163_V166>NKGE; 10:89682985-89682993

thyroidcarcinoma

c.165-2A>C; p.?; 10:89675248-89675248

central_nervous_system; brainglioma; gliomatosis_cerebri

c.493_631del139; p.G165fs*9; 10:89701855-89701996

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.165_492del328; p.F56fs*2; 10:89675250-89682988

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493_631del139; p.G165fs*9; 10:89701855-89701996

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.387_388insG; p.G129fs*50; 10:89682883-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>G; p.R130G; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493_631del139; p.G165fs*9; 10:89701855-89701996

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.690delA; p.G230fs*26; 10:89707645-89707645

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.761_765delAAGTA; p.K254fs*42; 10:89707716-89707720

thyroidcarcinoma; follicular_carcinoma

c.271G>C; p.E91Q; 10:89682767-89682767

prostatecarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

prostatecarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

prostatecarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

prostatecarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

prostatecarcinoma; adenocarcinoma

c.672_673insA; p.I224fs*18; 10:89707627-89707628

prostatecarcinoma; adenocarcinoma

c.672_673insA; p.I224fs*18; 10:89707627-89707628

prostatecarcinoma; adenocarcinoma

c.182A>G; p.H61R; 10:89675267-89675267

central_nervous_system; brainglioma; astrocytoma_Grade_II

c.592_594delATG; p.M198del; 10:89701954-89701956

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.263_264delAT; p.Y88fs*3; 10:89682759-89682760

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.284C>T; p.P95L; 10:89682780-89682780

endometriumhyperplasia; atypical

c.202T>C; p.Y68H; 10:89675287-89675287

endometriumhyperplasia; atypical

c.923_924delGT; p.R308fs*3; 10:89710752-89710753

endometriumhyperplasia; atypical

c.738_739insGT; p.P246fs*10; 10:89707693-89707694

endometriumhyperplasia; atypical

c.953_956delTTAC; p.L318fs*2; 10:89710782-89710785

endometriumhyperplasia; atypical

c.389G>T; p.R130L; 10:89682885-89682885

endometriumhyperplasia; atypical

c.801+?del?; p.?;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; diffuse_large_B_cell_lymphoma

c.801+?del?; p.?;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; diffuse_large_B_cell_lymphoma

c.47A>G; p.Y16C; 10:89614253-89614253

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; diffuse_large_B_cell_lymphoma

c.1-12A>G; p.?; 10:89614195-89614195

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; diffuse_large_B_cell_lymphoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma

c.867delA; p.V290fs*1; 10:89710696-89710696

endometriumcarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma

c.1040_1041delTC; p.F347fs*13; 10:89715037-89715038

endometriumcarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma

c.875delA; p.N292fs*15; 10:89710704-89710704

endometriumcarcinoma

c.1040_1041delTC; p.F347fs*13; 10:89715037-89715038

endometriumcarcinoma

c.800_801insA; p.K267fs*31; 10:89707755-89707756

endometriumcarcinoma

c.1040_1041delTC; p.F347fs*13; 10:89715037-89715038

endometriumcarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma

c.1040_1041delTC; p.F347fs*13; 10:89715037-89715038

endometriumcarcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma

c.1040_1041delTC; p.F347fs*13; 10:89715037-89715038

endometriumcarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma

c.1040_1041delTC; p.F347fs*13; 10:89715037-89715038

endometriumcarcinoma

c.259C>T; p.Q87*; 10:89682755-89682755

prostatecarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

prostatecarcinoma; adenocarcinoma

c.226_227delTA; p.Y76fs*1; 10:89680799-89680800

prostatecarcinoma; adenocarcinoma

c.69A>C; p.L23F; 10:89614275-89614275

central_nervous_system; brainglioma

c.70_71insA; p.D24fs*20; 10:89614276-89614277

central_nervous_system; brainglioma

c.279T>G; p.H93Q; 10:89682775-89682775

central_nervous_system; brainglioma

c.302T>C; p.I101T; 10:89682798-89682798

central_nervous_system; brainglioma

c.364_368delATTCA; p.I122fs*2; 10:89682860-89682864

central_nervous_system; brainglioma

c.370delT; p.C124fs*10; 10:89682866-89682866

central_nervous_system; brainglioma

c.376G>A; p.A126T; 10:89682872-89682872

central_nervous_system; brainglioma

c.404T>A; p.I135K; 10:89682900-89682900

central_nervous_system; brainglioma

c.955_956insA; p.T319fs*6; 10:89710784-89710785

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.45A>C; p.R15S; 10:89614251-89614251

central_nervous_system; brainglioma

c.170T>G; p.L57W; 10:89675255-89675255

central_nervous_system; brainglioma

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma

c.604delA; p.T202fs*19; 10:89701966-89701966

central_nervous_system; brainglioma

c.955_957delACT; p.T319del; 10:89710784-89710786

central_nervous_system; brainglioma

c.956_959delCTTT; p.T319fs*24; 10:89710785-89710788

central_nervous_system; brainglioma

c.180_181ins?; p.K60fs*9; 10:89675265-89675266

breastcarcinoma

c.710_718del9; p.K237_Y240>N; 10:89707665-89707673

breastcarcinoma

c.514_532del19; p.R172fs*5; 10:89701876-89701894

kidneycarcinoma

c.45_46insGA; p.R15fs*9; 10:89614251-89614252

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.385G>A; p.G129R; 10:89682881-89682881

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1009_1012delTTTT; p.F337fs*6; 10:89710838-89710841

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

endometriumcarcinoma; adenocarcinoma

c.38_40delAAA; p.K13del; 10:89614244-89614246

endometriumcarcinoma; adenocarcinoma

c.17_18delAA; p.K6fs*4; 10:89614223-89614224

endometriumcarcinoma; adenocarcinoma

c.143delA; p.N48fs*6; 10:89643825-89643825

endometriumcarcinoma; adenocarcinoma

c.134_135insCA; p.V45fs*10; 10:89643816-89643817

endometriumcarcinoma; adenocarcinoma

c.188_189insA; p.N63fs*11; 10:89675273-89675274

endometriumcarcinoma; squamous_cell_carcinoma

c.187_188delAA; p.N63fs*10; 10:89675272-89675273

endometriumcarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; adenocarcinoma

c.257_286del30; p.Q87_P96del; 10:89682753-89682782

endometriumcarcinoma; squamous_cell_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; adenocarcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; adenocarcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; squamous_cell_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; adenocarcinoma

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

endometriumcarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; squamous_cell_carcinoma

c.386G>T; p.G129V; 10:89682882-89682882

endometriumcarcinoma; adenocarcinoma

c.403A>G; p.I135V; 10:89682899-89682899

endometriumcarcinoma; adenocarcinoma

c.963_964insA; p.T321fs*3; 10:89710792-89710793

endometriumcarcinoma; adenocarcinoma

c.437_438insT; p.L146fs*34; 10:89682933-89682934

endometriumcarcinoma; adenocarcinoma

c.723_724insTT; p.E242fs*15; 10:89707678-89707679

endometriumcarcinoma; adenocarcinoma

c.733C>T; p.Q245*; 10:89707688-89707688

endometriumcarcinoma; adenocarcinoma

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

endometriumcarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; adenocarcinoma

c.742_743insA; p.P248fs*5; 10:89707697-89707698

endometriumcarcinoma; adenocarcinoma

c.895G>T; p.E299*; 10:89710724-89710724

endometriumcarcinoma; adenocarcinoma

c.895G>T; p.E299*; 10:89710724-89710724

endometriumcarcinoma; adenocarcinoma

c.942delA; p.E314fs*3; 10:89710771-89710771

endometriumcarcinoma; adenocarcinoma

c.957_958insT; p.T319fs*5; 10:89710786-89710787

endometriumcarcinoma; adenocarcinoma

c.963_964insA; p.T321fs*3; 10:89710792-89710793

endometriumcarcinoma; adenocarcinoma

c.634+3A>C; p.?; 10:89701999-89701999

endometriumcarcinoma; adenocarcinoma

c.963_964insA; p.T321fs*3; 10:89710792-89710793

endometriumcarcinoma; adenocarcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

endometriumcarcinoma; adenocarcinoma

c.950_954delTACTT; p.V317fs*6; 10:89710779-89710783

endometriumhyperplasia

c.170delT; p.L57fs*42; 10:89675255-89675255

meningesmeningioma; anaplastic

c.492+6delT; p.?; 10:89682994-89682994

central_nervous_system; supratentorialprimitive_neuroectodermal_tumour-medulloblastoma

c.115G>A; p.A39T; 10:89643797-89643797

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.69A>C; p.L23F; 10:89614275-89614275

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.70_71insA; p.D24fs*20; 10:89614276-89614277

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.279T>G; p.H93Q; 10:89682775-89682775

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.302T>C; p.I101T; 10:89682798-89682798

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.364_368delATTCA; p.I122fs*2; 10:89682860-89682864

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.370delT; p.C124fs*10; 10:89682866-89682866

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.376G>A; p.A126T; 10:89682872-89682872

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.404T>A; p.I135K; 10:89682900-89682900

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493-2A>G; p.?; 10:89701853-89701853

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.509G>T; p.S170I; 10:89701871-89701871

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.512A>C; p.Q171P; 10:89701874-89701874

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517delC; p.R173fs*10; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.737C>T; p.P246L; 10:89707692-89707692

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.754G>T; p.D252Y; 10:89707709-89707709

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.760_764delAAAGT; p.K254fs*42; 10:89707715-89707719

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1121delC; p.P374fs*30; 10:89715118-89715118

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.491delA; p.K164fs*3; 10:89682987-89682987

endometriumcarcinoma; endometrioid_carcinoma

c.733C>T; p.Q245*; 10:89707688-89707688

endometriumcarcinoma; endometrioid_carcinoma

c.270delT; p.F90fs*9; 10:89682766-89682766

endometriumcarcinoma; endometrioid_carcinoma

c.269T>C; p.F90S; 10:89682765-89682765

endometriumcarcinoma; endometrioid_carcinoma

c.867delA; p.V290fs*1; 10:89710696-89710696

endometriumcarcinoma; endometrioid_carcinoma

c.176C>A; p.S59*; 10:89675261-89675261

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.723delT; p.F241fs*15; 10:89707678-89707678

endometriumcarcinoma; endometrioid_carcinoma

c.367C>T; p.H123Y; 10:89682863-89682863

endometriumcarcinoma; endometrioid_carcinoma

c.219_220delAA; p.E73fs*4; 10:89680792-89680793

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.188delA; p.N63fs*36; 10:89675273-89675273

endometriumcarcinoma; endometrioid_carcinoma

c.361_435del75; p.A121_F145del; 10:89682857-89682931

endometriumcarcinoma; endometrioid_carcinoma

c.277C>G; p.H93D; 10:89682773-89682773

endometriumcarcinoma; endometrioid_carcinoma

c.70G>A; p.D24N; 10:89614276-89614276

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

endometriumcarcinoma; endometrioid_carcinoma

c.284C>T; p.P95L; 10:89682780-89682780

endometriumcarcinoma; endometrioid_carcinoma

c.112C>T; p.P38S; 10:89643794-89643794

skinmalignant_melanoma

c.675_676insTA; p.Y225fs*31; 10:89707630-89707631

skinmalignant_melanoma

c.416T>G; p.L139*; 10:89682912-89682912

skinmalignant_melanoma

c.380G>A; p.G127E; 10:89682876-89682876

skinmalignant_melanoma

c.37A>G; p.K13E; 10:89614243-89614243

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.197_198ins14; p.K66fs*38; 10:89675282-89675283

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.209+1delGTAAGTATGTTTTCTTATTT; p.?; 10:89675295-89675314

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.209+4delAGTA; p.?; 10:89675298-89675301

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.209+5G>T; p.?; 10:89675299-89675299

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.210-1G>T; p.?; 10:89680782-89680782

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.361G>C; p.A121P; 10:89682857-89682857

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.406T>C; p.C136R; 10:89682902-89682902

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.463T>C; p.Y155H; 10:89682959-89682959

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.513G>C; p.Q171H; 10:89701875-89701875

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.518G>A; p.R173H; 10:89701880-89701880

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.526_528delTAT; p.Y176del; 10:89701888-89701890

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.557delT; p.L186fs*13; 10:89701919-89701919

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.635-12T>G; p.?; 10:89707578-89707578

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.635-17T>G; p.?; 10:89707573-89707573

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.655C>T; p.Q219*; 10:89707610-89707610

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.942delA; p.E314fs*3; 10:89710771-89710771

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.955_957delACT; p.T319del; 10:89710784-89710786

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.967_968ins37; p.N323fs*7; 10:89710796-89710797

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; gliosarcoma

c.131G>A; p.G44D; 10:89643813-89643813

central_nervous_system; brainglioma; oligodendroglioma_Grade_II

c.235G>A; p.A79T; 10:89680808-89680808

central_nervous_system; brainglioma; oligodendroglioma_Grade_II

c.655C>T; p.Q219*; 10:89707610-89707610

central_nervous_system; brainglioma; astrocytoma_Grade_I

c.80_90del11; p.Y27fs*1; 10:89643762-89643772

endometriumcarcinoma; endometrioid_carcinoma

c.160G>T; p.V54L; 10:89643842-89643842

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.451G>A; p.A151T; 10:89682947-89682947

endometriumcarcinoma; clear_cell_carcinoma

c.498_568>70; p.V166fs*17; 10:89701860-89701930

endometriumcarcinoma; clear_cell_carcinoma

c.7G>T; p.A3S; 10:89614213-89614213

endometriumother; solitary_cyst

c.498_568>70; p.V166fs*17; 10:89701860-89701930

endometriumother; solitary_cyst

c.451G>A; p.A151T; 10:89682947-89682947

endometriumother; solitary_cyst

c.451G>A; p.A151T; 10:89682947-89682947

endometriumother; solitary_cyst

c.451G>A; p.A151T; 10:89682947-89682947

endometriumother; solitary_cyst

c.451G>A; p.A151T; 10:89682947-89682947

endometriumother; solitary_cyst

c.498_568>70; p.V166fs*17; 10:89701860-89701930

endometriumother; solitary_cyst

c.940G>A; p.E314K; 10:89710769-89710769

endometriumother; solitary_cyst

c.416T>G; p.L139*; 10:89682912-89682912

skinmalignant_melanoma

c.492_493insA; p.K164fs*15;

skinmalignant_melanoma

c.17_18delAA; p.K6fs*4; 10:89614223-89614224

skinmalignant_melanoma

c.19G>T; p.E7*; 10:89614225-89614225

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.212G>A; p.C71Y; 10:89680785-89680785

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>G; p.R130G; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.742_743insC; p.P248fs*5; 10:89707697-89707698

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1021T>G; p.F341V; 10:89710850-89710850

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.510_514delTCAGA; p.S170fs*8; 10:89701872-89701876

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.595_597delATG; p.M199del; 10:89701957-89701959

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.464A>G; p.Y155C; 10:89682960-89682960

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.234C>T; p.T78T; 10:89680807-89680807

lungcarcinoma; small_cell_carcinoma

c.1007A>T; p.Y336F; 10:89710836-89710836

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1005A>T; p.R335R; 10:89710834-89710834

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1026+23T>G; p.?; 10:89710878-89710878

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1026+16C>A; p.?; 10:89710871-89710871

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1027-2A>G; p.?; 10:89715022-89715022

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.373A>G; p.K125E; 10:89682869-89682869

large_intestinecarcinoma; adenocarcinoma

c.457G>A; p.D153N; 10:89682953-89682953

large_intestinecarcinoma; adenocarcinoma

c.650T>C; p.V217A; 10:89707605-89707605

large_intestinecarcinoma; adenocarcinoma

c.457G>T; p.D153Y; 10:89682953-89682953

large_intestinecarcinoma; adenocarcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

large_intestinecarcinoma; adenocarcinoma

c.969T>A; p.N323K; 10:89710798-89710798

large_intestinecarcinoma; adenocarcinoma

c.185A>G; p.K62R; 10:89675270-89675270

large_intestinecarcinoma; adenocarcinoma

c.194A>G; p.Y65C; 10:89675279-89675279

large_intestinecarcinoma; adenocarcinoma

c.373A>T; p.K125*; 10:89682869-89682869

large_intestinecarcinoma; adenocarcinoma

c.448G>C; p.E150Q; 10:89682944-89682944

large_intestinecarcinoma; adenocarcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

large_intestinecarcinoma; adenocarcinoma

c.46_47insT; p.Y16fs*28; 10:89614252-89614253

endometriumcarcinoma; endometrioid_carcinoma

c.195C>G; p.Y65*; 10:89675280-89675280

endometriumcarcinoma; endometrioid_carcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.353_354insA; p.H118fs*8; 10:89682849-89682850

endometriumcarcinoma; endometrioid_carcinoma

c.353_354insA; p.H118fs*8; 10:89682849-89682850

endometriumcarcinoma; endometrioid_carcinoma

c.380G>T; p.G127V; 10:89682876-89682876

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>C; p.R130P; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.405A>G; p.I135M; 10:89682901-89682901

endometriumcarcinoma; endometrioid_carcinoma

c.407G>T; p.C136F; 10:89682903-89682903

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389delG; p.R130fs*4; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.549_550insA; p.K183fs*6; 10:89701911-89701912

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.724G>A; p.E242K; 10:89707679-89707679

endometriumcarcinoma; endometrioid_carcinoma

c.752G>T; p.G251V; 10:89707707-89707707

endometriumcarcinoma; endometrioid_carcinoma

c.760A>T; p.K254*; 10:89707715-89707715

endometriumcarcinoma; endometrioid_carcinoma

c.766G>T; p.E256*; 10:89707721-89707721

endometriumcarcinoma; endometrioid_carcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

endometriumcarcinoma; endometrioid_carcinoma

c.477G>T; p.R159S; 10:89682973-89682973

large_intestine; coloncarcinoma; adenocarcinoma

c.477G>T; p.R159S; 10:89682973-89682973

large_intestine; coloncarcinoma; adenocarcinoma

c.112C>T; p.P38S; 10:89643794-89643794

skin; trunkmalignant_melanoma; superficial_spreading

c.737C>T; p.P246L; 10:89707692-89707692

skin; legmalignant_melanoma; superficial_spreading

c.697C>T; p.R233*; 10:89707652-89707652

cervixcarcinoma; endometrioid_adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

cervixcarcinoma; endometrioid_adenocarcinoma

c.416_419delTATT; p.L139fs*7; 10:89682912-89682915

cervixcarcinoma; endocervical_adenocarcinoma

c.1038_1053del16; p.Y346fs*1; 10:89715035-89715050

cervixcarcinoma; endocervical_adenocarcinoma

c.686C>G; p.S229*; 10:89707641-89707641

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.686C>G; p.S229*; 10:89707641-89707641

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.686C>G; p.S229*; 10:89707641-89707641

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.634+11G>A; p.?; 10:89702007-89702007

skinmalignant_melanoma; superficial_spreading

c.80-152A>G; p.?; 10:89643610-89643610

skinmalignant_melanoma; nodular

c.1-22C>T; p.?; 10:89614185-89614185

skinmalignant_melanoma; nodular

c.164+79G>A; p.?; 10:89643925-89643925

skinmalignant_melanoma

c.1016C>T; p.P339L; 10:89710845-89710845

skinmalignant_melanoma

c.1-101C>T; p.?; 10:89614106-89614106

skinmalignant_melanoma

c.209+53G>A; p.?; 10:89675347-89675347

skinmalignant_melanoma

c.235G>A; p.A79T; 10:89680808-89680808

skinmalignant_melanoma

c.1-22C>T; p.?; 10:89614185-89614185

skinmalignant_melanoma

c.165-63A>T; p.?; 10:89675187-89675187

skinmalignant_melanoma

c.339T>G; p.S113R; 10:89682835-89682835

endometriumhyperplasia; simple-atypical

c.303C>T; p.I101I; 10:89682799-89682799

endometriumhyperplasia; complex-atypical

c.594delG; p.M198fs*23; 10:89701956-89701956

endometriumhyperplasia; complex-atypical

c.568_572delCCAGT; p.P190fs*10; 10:89701930-89701934

endometriumhyperplasia; complex

c.388C>G; p.R130G; 10:89682884-89682884

endometriumhyperplasia; complex-atypical

c.437delT; p.L146fs*1; 10:89682933-89682933

endometriumhyperplasia; complex-atypical

c.697C>T; p.R233*; 10:89707652-89707652

endometriumhyperplasia; complex-atypical

c.892C>T; p.Q298*; 10:89710721-89710721

endometriumhyperplasia; complex-atypical

c.740T>A; p.L247*; 10:89707695-89707695

endometriumhyperplasia; complex-atypical

c.40delA; p.R14fs*10; 10:89614246-89614246

endometriumcarcinoma; endometrioid_carcinoma

c.80_81delAT; p.Y27fs*16; 10:89643762-89643763

endometriumcarcinoma; endometrioid_carcinoma

c.118G>T; p.E40*; 10:89643800-89643800

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.187delA; p.N63fs*36; 10:89675272-89675272

endometriumcarcinoma; endometrioid_carcinoma

c.201_202insTAT; p.I67_Y68insY; 10:89675286-89675287

endometriumcarcinoma; endometrioid_carcinoma

c.312_313insT; p.C105fs*2; 10:89682808-89682809

endometriumcarcinoma; endometrioid_carcinoma

c.387delA; p.G129fs*5; 10:89682883-89682883

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.640C>T; p.Q214*; 10:89707595-89707595

endometriumcarcinoma; mixed_adenosquamous_carcinoma

c.640C>T; p.Q214*; 10:89707595-89707595

endometriumcarcinoma; endometrioid_carcinoma

c.727_739del13; p.F243fs*9; 10:89707682-89707694

endometriumcarcinoma; endometrioid_carcinoma

c.799delA; p.K267fs*9; 10:89707754-89707754

endometriumcarcinoma; endometrioid_carcinoma

c.955_956insA; p.T319fs*6; 10:89710784-89710785

endometriumcarcinoma; endometrioid_carcinoma

c.799delA; p.K267fs*9; 10:89707754-89707754

endometriumcarcinoma; endometrioid_carcinoma

c.801_802ins?; p.K267_D268ins?; 10:89707756-89707757

endometriumcarcinoma; mixed_adenosquamous_carcinoma

c.864_868delAAAAG; p.E288fs*8; 10:89710693-89710697

endometriumcarcinoma; endometrioid_carcinoma

c.938delA; p.K313fs*4; 10:89710767-89710767

endometriumcarcinoma; mixed_adenosquamous_carcinoma

c.968delA; p.N323fs*21; 10:89710797-89710797

endometriumcarcinoma; endometrioid_carcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

endometriumcarcinoma; endometrioid_carcinoma

c.1047_1048insA; p.T350fs*11; 10:89715044-89715045

endometriumcarcinoma; endometrioid_carcinoma

c.984_987delAAAT; p.A328fs*15; 10:89710813-89710816

endometriumcarcinoma; endometrioid_carcinoma

c.987_990delTAAA; p.N329fs*14; 10:89710816-89710819

endometriumcarcinoma; endometrioid_carcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

endometriumcarcinoma; endometrioid_carcinoma

c.1012delT; p.S338fs*6; 10:89710841-89710841

endometriumcarcinoma; endometrioid_carcinoma

c.209+?ins?; p.?;

livercarcinoma; hepatocellular_carcinoma

c.209+?ins?; p.?;

livercarcinoma; hepatocellular_carcinoma

c.910T>G; p.C304G; 10:89710739-89710739

livercarcinoma; hepatocellular_carcinoma

c.927A>C; p.A309A; 10:89710756-89710756

livercarcinoma; hepatocellular_carcinoma

c.45_46delAT; p.Y16fs*27;

breastcarcinoma; basal_(triple-negative)_carcinoma

c.464A>G; p.Y155C; 10:89682960-89682960

breastcarcinoma; basal_(triple-negative)_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

breastcarcinoma; ductal_carcinoma

c.389G>C; p.R130P; 10:89682885-89682885

breastcarcinoma; basal_(triple-negative)_carcinoma

c.644T>C; p.F215S;

breastcarcinoma; ductal_carcinoma

c.263A>G; p.Y88C; 10:89682759-89682759

breastcarcinoma; ductal_carcinoma

c.105G>A; p.M35I;

central_nervous_system; temporal_lobeglioma; ependymoma

c.?; p.R233*;

central_nervous_system; brainglioma

c.1_1212del1212; p.0?; 10:89614207-89715209

central_nervous_system; brainglioma

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma

c.697C>T; p.R233*; 10:89707652-89707652

lungcarcinoma; small_cell_carcinoma

c.1196_1212+28del45; p.Q399fs*48; 10:89715193-89715209

NSmalignant_melanoma

c.723_724insTT; p.E242fs*15; 10:89707678-89707679

NSmalignant_melanoma

c.1_1212del1212; p.0?;

NSmalignant_melanoma

c.?; p.C136R;

NSmalignant_melanoma

c.?; p.T167A;

NSmalignant_melanoma

c.?; p.R130Q;

NSmalignant_melanoma

c.499A>G; p.T167A; 10:89701861-89701861

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; hairy_cell_leukaemia

c.499A>G; p.T167A; 10:89701861-89701861

skinmalignant_melanoma

c.499A>G; p.T167A; 10:89701861-89701861

skinmalignant_melanoma

c.428delG; p.G143fs*4; 10:89682924-89682924

NSmalignant_melanoma

c.548_549insA; p.N184fs*6; 10:89701910-89701911

NSmalignant_melanoma

c.492+2T>A; p.?; 10:89682990-89682990

skinmalignant_melanoma

c.499A>G; p.T167A; 10:89701861-89701861

skinmalignant_melanoma

c.546_547insA; p.K183fs*7; 10:89701908-89701909

skinmalignant_melanoma

c.?; p.W274G;

ovarycarcinoma; serous_carcinoma

c.?; p.R130*;

ovarycarcinoma; serous_carcinoma

c.?; p.R233*;

ovarycarcinoma; serous_carcinoma

c.493G>A; p.G165R; 10:89701855-89701855

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.183T>A; p.H61Q;

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.493G>A; p.G165R; 10:89701855-89701855

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.276C>A; p.D92E; 10:89682772-89682772

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.276C>A; p.D92E; 10:89682772-89682772

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.212_255del44; p.C71fs*6; 10:89680785-89682751

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.950_953delTACT; p.T319fs*1; 10:89710779-89710782

soft_tissue; fibrous_tissue_and_uncertain_osarcoma

c.?; p.T26fs;

central_nervous_system; brainglioma

c.723_724insTT; p.E242fs*15; 10:89707678-89707679

central_nervous_system; cerebrumglioma; astrocytoma_Grade_IV

c.?; p.K6fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.V290fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.?; p.K164fs*?;

endometriumcarcinoma; endometrioid_carcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.722T>C; p.F241S; 10:89707677-89707677

large_intestinecarcinoma; adenocarcinoma

c.800delA; p.K267fs*9; 10:89707755-89707755

large_intestinecarcinoma; adenocarcinoma

c.202T>C; p.Y68H; 10:89675287-89675287

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; B_cell_lymphoma_unspecified

c.484G>C; p.D162H; 10:89682980-89682980

haematopoietic_and_lymphoid_tissue; lymph_nodelymphoid_neoplasm; B_cell_lymphoma_unspecified

c.517C>T; p.R173C; 10:89701879-89701879

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.170T>G; p.L57W; 10:89675255-89675255

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.1027-1G>C; p.?;

prostateadenoma

c.?; p.E291*;

stomachcarcinoma; adenocarcinoma

c.702_703insAAGG; p.E235fs*9; 10:89707657-89707658

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.132C>T; p.G44G; 10:89643814-89643814

urinary_tract; bladdercarcinoma; transitional_cell_carcinoma

c.143A>T; p.N48I; 10:89643825-89643825

urinary_tract; bladdercarcinoma; transitional_cell_carcinoma

c.780_780delA; p.K260fs*6; 10:89707735-89707735

soft_tissue; fibrous_tissue_and_uncertain_omalignant_fibrous_histiocytoma-pleomorphic_sarcoma

c.780_780delA; p.K260fs*6; 10:89707735-89707735

soft_tissue; fibrous_tissue_and_uncertain_omalignant_fibrous_histiocytoma-pleomorphic_sarcoma

c.1_1212del1212; p.0?;

lungcarcinoma; adenocarcinoma

c.97_99delATT; p.I33del; 10:89643779-89643781

prostatecarcinoma

c.125T>G; p.L42R; 10:89643807-89643807

central_nervous_system; brainglioma

c.125T>G; p.L42R; 10:89643807-89643807

central_nervous_system; brainglioma

c.475delA; p.R159fs*8; 10:89682971-89682971

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.474delA; p.R159fs*8; 10:89682970-89682970

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697C>T; p.R233*; 10:89707652-89707652

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.578T>C; p.L193P; 10:89701940-89701940

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.578T>C; p.L193P; 10:89701940-89701940

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.287C>T; p.P96L; 10:89682783-89682783

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.287C>T; p.P96L; 10:89682783-89682783

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.445C>T; p.Q149*; 10:89682941-89682941

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.445C>T; p.Q149*; 10:89682941-89682941

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.500C>T; p.T167I; 10:89701862-89701862

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.389delG; p.R130fs*4; 10:89682885-89682885

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.517C>T; p.R173C; 10:89701879-89701879

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.232_233delAC; p.T78fs*4; 10:89680805-89680806

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.230_231delAC; p.T78fs*4; 10:89680803-89680804

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.391A>G; p.T131A; 10:89682887-89682887

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.391A>G; p.T131A; 10:89682887-89682887

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.959T>A; p.L320*; 10:89710788-89710788

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.721T>C; p.F241L; 10:89707676-89707676

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.721T>C; p.F241L; 10:89707676-89707676

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.479C>T; p.T160I; 10:89682975-89682975

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.531T>G; p.Y177*; 10:89701893-89701893

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.531T>G; p.Y177*; 10:89701893-89701893

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.703G>T; p.E235*; 10:89707658-89707658

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.830C>T; p.T277I; 10:89710659-89710659

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.952_955delCTTA; p.T318fs*2; 10:89710781-89710784

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.314_315delGT; p.C105fs*1; 10:89682810-89682811

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.227_228delAT; p.Y76fs*1; 10:89680800-89680801

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.500C>G; p.T167S; 10:89701862-89701862

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.500C>G; p.T167S; 10:89701862-89701862

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.982_986delGCAAA; p.A328fs*1; 10:89710811-89710815

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.107G>A; p.G36E; 10:89643789-89643789

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.107G>A; p.G36E; 10:89643789-89643789

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.395G>A; p.G132D; 10:89682891-89682891

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.395G>A; p.G132D; 10:89682891-89682891

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.969delT; p.N323fs*21; 10:89710798-89710798

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.968delA; p.N323fs*21; 10:89710797-89710797

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.276C>A; p.D92E; 10:89682772-89682772

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.276C>A; p.D92E; 10:89682772-89682772

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.476G>A; p.R159K; 10:89682972-89682972

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.476G>A; p.R159K; 10:89682972-89682972

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.227_228delAT; p.Y76fs*1; 10:89680800-89680801

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.226_227delTA; p.Y76fs*1; 10:89680799-89680800

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.203A>G; p.Y68C; 10:89675288-89675288

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.203A>G; p.Y68C; 10:89675288-89675288

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1003C>T; p.R335*; 10:89710832-89710832

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.607_608delAT; p.I203fs*39; 10:89701969-89701970

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1133_1136delGATA; p.R378fs*>25; 10:89715130-89715133

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.841delC; p.P281fs*10; 10:89710670-89710670

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.787A>T; p.K263*; 10:89707742-89707742

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.787A>T; p.K263*; 10:89707742-89707742

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.195C>A; p.Y65*; 10:89675280-89675280

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.139A>G; p.R47G; 10:89643821-89643821

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.139A>G; p.R47G; 10:89643821-89643821

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.388C>T; p.R130*; 10:89682884-89682884

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.812T>C; p.F271S; 10:89710641-89710641

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.523G>T; p.V175L; 10:89701885-89701885

ovarycarcinoma; serous_carcinoma

c.82_83insGATA; p.I28fs*17; 10:89643764-89643765

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.990_991insA; p.D331fs*12; 10:89710819-89710820

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.697delC; p.R233fs*23; 10:89707652-89707652

ovarycarcinoma; serous_carcinoma

c.382A>C; p.K128Q;

lungcarcinoma; squamous_cell_carcinoma

c.703G>T; p.E235*; 10:89707658-89707658

lungcarcinoma; squamous_cell_carcinoma

c.959T>A; p.L320*; 10:89710788-89710788

lungcarcinoma; squamous_cell_carcinoma

c.1038C>G; p.Y346*;

lungcarcinoma; squamous_cell_carcinoma

c.386G>A; p.G129E; 10:89682882-89682882

lungcarcinoma; squamous_cell_carcinoma

c.274G>C; p.D92H; 10:89682770-89682770

lungcarcinoma; squamous_cell_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

lungcarcinoma; squamous_cell_carcinoma

c.511C>A; p.Q171K;

lungcarcinoma; squamous_cell_carcinoma

c.733C>T; p.Q245*; 10:89707688-89707688

lungcarcinoma; squamous_cell_carcinoma

c.319G>A; p.D107N; 10:89682815-89682815

lung; right_lower_lobecarcinoma; adenocarcinoma

c.105G>T; p.M35I;

lung; left_upper_lobecarcinoma; adenocarcinoma

c.176C>G; p.S59*;

lungcarcinoma; squamous_cell_carcinoma

c.743C>A; p.P248H;

lungcarcinoma; squamous_cell_carcinoma

c.741A>C; p.L247F;

lungcarcinoma; squamous_cell_carcinoma

c.182A>G; p.H61R; 10:89675267-89675267

lungcarcinoma; squamous_cell_carcinoma

c.628_634+18del25; p.?;

ovarycarcinoma; serous_carcinoma

c.367C>T; p.H123Y; 10:89682863-89682863

ovarycarcinoma; serous_carcinoma

c.493-2A>C; p.?;

ovarycarcinoma; serous_carcinoma

c.733C>T; p.Q245*; 10:89707688-89707688

lungcarcinoma; squamous_cell_carcinoma

c.106G>T; p.G36*; 10:89643788-89643788

lung; right_upper_lobecarcinoma; adenocarcinoma

c.188_193delACCATT; p.H64_Y65delHY;

breastcarcinoma

c.509G>A; p.S170N; 10:89701871-89701871

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.574G>A; p.A192T;

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.635-1G>T; p.?; 10:89707589-89707589

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.954_955insA; p.T319fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.1003C>G; p.R335G;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.651delC; p.C218fs*3;

endometriumcarcinoma; endometrioid_carcinoma

c.198G>T; p.K66N; 10:89675283-89675283

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.796_797insAAAAG; p.D268fs*10;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.1013_1026+4del18; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.754G>T; p.D252Y; 10:89707709-89707709

endometriumcarcinoma; endometrioid_carcinoma

c.47_49delATC; p.Y16_Q17>*;

endometriumcarcinoma; endometrioid_carcinoma

c.455T>G; p.L152R;

endometriumcarcinoma; endometrioid_carcinoma

c.187_188insACCATTAC; p.K66fs*36;

endometriumcarcinoma; endometrioid_carcinoma

c.545_546insA; p.N184fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.278A>G; p.H93R; 10:89682774-89682774

endometriumcarcinoma; endometrioid_carcinoma

c.216_217insGAAA; p.H75fs*4;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.774delC; p.H259fs*7;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.209+1_209+4delgtaa; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.348_358del11; p.N117fs*5;

endometriumcarcinoma; endometrioid_carcinoma

c.518G>A; p.R173H; 10:89701880-89701880

endometriumcarcinoma; endometrioid_carcinoma

c.257C>T; p.A86V;

endometriumcarcinoma; endometrioid_carcinoma

c.968_970delATG; p.D324delD;

endometriumcarcinoma; endometrioid_carcinoma

c.1031A>G; p.K344R; 10:89715028-89715028

large_intestine; coloncarcinoma; adenocarcinoma

c.383A>G; p.K128R;

large_intestine; coloncarcinoma; adenocarcinoma

c.77C>T; p.T26I;

large_intestine; coloncarcinoma; adenocarcinoma

c.381A>G; p.G127G;

large_intestine; coloncarcinoma; adenocarcinoma

c.1190A>G; p.H397R;

large_intestine; coloncarcinoma; adenocarcinoma

c.138C>A; p.Y46*;

large_intestine; coloncarcinoma; adenocarcinoma

c.396T>C; p.G132G;

large_intestine; coloncarcinoma; adenocarcinoma

c.762A>G; p.K254K;

large_intestine; coloncarcinoma; adenocarcinoma

c.355G>A; p.V119I;

large_intestine; caecumcarcinoma; adenocarcinoma

c.375A>G; p.K125K;

large_intestine; caecumcarcinoma; adenocarcinoma

c.387A>G; p.G129G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.681C>A; p.S227S;

large_intestine; caecumcarcinoma; adenocarcinoma

c.347A>G; p.D116G; 10:89682843-89682843

large_intestine; caecumcarcinoma; adenocarcinoma

c.45A>G; p.R15R;

large_intestine; coloncarcinoma; adenocarcinoma

c.81T>C; p.Y27Y;

large_intestine; coloncarcinoma; adenocarcinoma

c.419T>C; p.L140S;

large_intestine; coloncarcinoma; adenocarcinoma

c.440A>C; p.K147T;

large_intestine; coloncarcinoma; adenocarcinoma

c.524T>C; p.V175A;

large_intestine; coloncarcinoma; adenocarcinoma

c.751G>A; p.G251S;

large_intestine; coloncarcinoma; adenocarcinoma

c.753T>C; p.G251G;

large_intestine; coloncarcinoma; adenocarcinoma

c.811T>C; p.F271L;

large_intestine; coloncarcinoma; adenocarcinoma

c.851A>G; p.E284G;

large_intestine; coloncarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; coloncarcinoma; adenocarcinoma

c.163A>G; p.R55G; 10:89643845-89643845

large_intestine; coloncarcinoma; adenocarcinoma

c.872A>G; p.E291G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.813T>C; p.F271F;

large_intestine; coloncarcinoma; adenocarcinoma

c.20A>G; p.E7G;

large_intestine; coloncarcinoma; adenocarcinoma

c.872A>G; p.E291G;

large_intestine; coloncarcinoma; adenocarcinoma

c.347A>G; p.D116G; 10:89682843-89682843

large_intestine; coloncarcinoma; adenocarcinoma

c.530A>T; p.Y177F;

large_intestine; coloncarcinoma; adenocarcinoma

c.953T>C; p.L318P;

large_intestine; coloncarcinoma; adenocarcinoma

c.381A>G; p.G127G;

large_intestine; coloncarcinoma; adenocarcinoma

c.447A>G; p.Q149Q;

large_intestine; coloncarcinoma; adenocarcinoma

c.592A>G; p.M198V;

large_intestine; coloncarcinoma; adenocarcinoma

c.781C>T; p.Q261*; 10:89707736-89707736

large_intestine; coloncarcinoma; adenocarcinoma

c.739T>C; p.L247L;

large_intestine; coloncarcinoma; adenocarcinoma

c.2T>C; p.M1T; 10:89614208-89614208

large_intestine; coloncarcinoma; adenocarcinoma

c.347A>G; p.D116G; 10:89682843-89682843

large_intestine; coloncarcinoma; adenocarcinoma

c.975T>C; p.L325L;

large_intestine; coloncarcinoma; adenocarcinoma

c.217_218delGA; p.E73fs*4;

breastcarcinoma

c.404T>A; p.I135K; 10:89682900-89682900

breastcarcinoma

c.858_865delCTCAGAAA; p.E288fs*7;

breastcarcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

breastcarcinoma

c.138C>G; p.Y46*; 10:89643820-89643820

breastcarcinoma

c.342A>G; p.E114E;

large_intestine; coloncarcinoma; adenocarcinoma

c.454C>A; p.L152I;

large_intestine; coloncarcinoma; adenocarcinoma

c.879A>G; p.G293G;

large_intestine; coloncarcinoma; adenocarcinoma

c.953T>C; p.L318P;

large_intestine; coloncarcinoma; adenocarcinoma

c.1094T>A; p.V365E;

large_intestine; coloncarcinoma; adenocarcinoma

c.19G>T; p.E7*; 10:89614225-89614225

large_intestine; coloncarcinoma; adenocarcinoma

c.324T>C; p.L108L;

large_intestine; coloncarcinoma; adenocarcinoma

c.1092T>C; p.S364S;

large_intestine; coloncarcinoma; adenocarcinoma

c.370T>C; p.C124R;

large_intestine; coloncarcinoma; adenocarcinoma

c.714C>T; p.F238F;

large_intestine; coloncarcinoma; adenocarcinoma

c.760A>G; p.K254E; 10:89707715-89707715

large_intestine; coloncarcinoma; adenocarcinoma

c.731C>A; p.P244H;

large_intestine; coloncarcinoma; adenocarcinoma

c.261A>G; p.Q87Q;

large_intestine; coloncarcinoma; adenocarcinoma

c.444A>G; p.A148A;

large_intestine; coloncarcinoma; adenocarcinoma

c.690A>G; p.G230G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

large_intestine; caecumcarcinoma; adenocarcinoma

c.646G>A; p.V216M; 10:89707601-89707601

large_intestine; caecumcarcinoma; adenocarcinoma

c.373delA; p.A126fs*8;

large_intestine; coloncarcinoma; adenocarcinoma

c.821G>T; p.W274L;

large_intestine; coloncarcinoma; adenocarcinoma

c.507C>T; p.P169P;

large_intestine; coloncarcinoma; adenocarcinoma

c.688G>T; p.G230*;

large_intestine; coloncarcinoma; adenocarcinoma

c.821G>T; p.W274L;

large_intestine; coloncarcinoma; adenocarcinoma

c.721T>C; p.F241L; 10:89707676-89707676

large_intestine; coloncarcinoma; adenocarcinoma

c.466G>A; p.G156R; 10:89682962-89682962

large_intestine; coloncarcinoma; adenocarcinoma

c.246T>C; p.N82N;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

large_intestine; caecumcarcinoma; adenocarcinoma

c.448G>T; p.E150*;

large_intestine; caecumcarcinoma; adenocarcinoma

c.378T>C; p.A126A;

large_intestine; caecumcarcinoma; adenocarcinoma

c.388C>T; p.R130*; 10:89682884-89682884

large_intestine; caecumcarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestine; caecumcarcinoma; adenocarcinoma

c.204C>A; p.Y68*;

large_intestine; coloncarcinoma; adenocarcinoma

c.1123G>A; p.D375N; 10:89715120-89715120

large_intestine; coloncarcinoma; adenocarcinoma

c.516G>A; p.R172R;

large_intestine; coloncarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

large_intestine; coloncarcinoma; adenocarcinoma

c.895G>T; p.E299*; 10:89710724-89710724

large_intestine; coloncarcinoma; adenocarcinoma

c.41G>T; p.R14M;

large_intestine; coloncarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

large_intestine; coloncarcinoma; adenocarcinoma

c.738G>A; p.P246P;

large_intestine; coloncarcinoma; adenocarcinoma

c.546_547delAA; p.K183fs*6;

breastcarcinoma

c.725A>G; p.E242G;

large_intestine; coloncarcinoma; adenocarcinoma

c.329A>G; p.Q110R;

large_intestine; coloncarcinoma; adenocarcinoma

c.62T>C; p.F21S; 10:89614268-89614268

large_intestine; coloncarcinoma; adenocarcinoma

c.449A>C; p.E150A;

large_intestine; caecumcarcinoma; adenocarcinoma

c.975T>C; p.L325L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1037A>G; p.Y346C;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1013C>T; p.S338F;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1030A>G; p.K344E;

large_intestine; caecumcarcinoma; adenocarcinoma

c.923G>A; p.R308H;

large_intestine; rectumcarcinoma; adenocarcinoma

c.896A>G; p.E299G;

large_intestine; rectumNS

c.862G>A; p.E288K; 10:89710691-89710691

large_intestine; rectumNS

c.485A>G; p.D162G; 10:89682981-89682981

large_intestine; rectumcarcinoma; adenocarcinoma

c.699A>G; p.R233R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.61T>C; p.F21L;

large_intestine; rectumcarcinoma; adenocarcinoma

c.860C>T; p.S287L;

large_intestine; rectumcarcinoma; adenocarcinoma

c.920A>G; p.E307G;

large_intestine; rectumcarcinoma; adenocarcinoma

c.45A>G; p.R15R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.664G>A; p.V222M;

large_intestine; rectumcarcinoma; adenocarcinoma

c.176C>T; p.S59L; 10:89675261-89675261

large_intestine; rectumcarcinoma; adenocarcinoma

c.19G>T; p.E7*; 10:89614225-89614225

large_intestine; rectumcarcinoma; adenocarcinoma

c.202T>A; p.Y68N; 10:89675287-89675287

large_intestine; rectumcarcinoma; adenocarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

large_intestine; rectumcarcinoma; adenocarcinoma

c.494G>A; p.G165E; 10:89701856-89701856

large_intestine; rectumcarcinoma; adenocarcinoma

c.1015C>T; p.P339S; 10:89710844-89710844

large_intestine; rectumcarcinoma; adenocarcinoma

c.653G>T; p.C218F;

large_intestine; rectumcarcinoma; adenocarcinoma

c.1011T>A; p.F337L;

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.384G>C; p.K128N;

breastcarcinoma

c.264T>A; p.Y88*;

breastcarcinoma

c.140delG; p.N48fs*6;

breastcarcinoma

c.545_546insA; p.N184fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.408T>A; p.C136*;

endometriumcarcinoma; endometrioid_carcinoma

c.80-2A>C; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.810G>A; p.M270I;

endometriumcarcinoma; endometrioid_carcinoma

c.127G>T; p.E43*;

endometriumcarcinoma; endometrioid_carcinoma

c.708_709insA; p.F238fs*5;

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.176_189del14; p.K60fs*9;

endometriumcarcinoma; endometrioid_carcinoma

c.94_96delATT; p.I32del; 10:89643776-89643778

endometriumcarcinoma; endometrioid_carcinoma

c.387delA; p.G129fs*5; 10:89682883-89682883

endometriumcarcinoma; endometrioid_carcinoma

c.11_14delTCAT; p.I4fs*19;

endometriumcarcinoma; endometrioid_carcinoma

c.373_399del27; p.K125_V133delKAGKGRTGV;

endometriumcarcinoma; endometrioid_carcinoma

c.509G>A; p.S170N; 10:89701871-89701871

endometriumcarcinoma; endometrioid_carcinoma

c.389G>C; p.R130P; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.406T>C; p.C136R; 10:89682902-89682902

endometriumcarcinoma; endometrioid_carcinoma

c.134_135insATAC; p.R47fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.892C>T; p.Q298*; 10:89710721-89710721

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.418_419insTAC; p.L140_H141insL;

endometriumcarcinoma; endometrioid_carcinoma

c.28A>C; p.S10R;

breastcarcinoma

c.367C>G; p.H123D;

breastcarcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

breastcarcinoma

c.383A>G; p.K128R;

large_intestine; caecumcarcinoma; adenocarcinoma

c.821G>T; p.W274L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.823G>T; p.V275L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.892C>T; p.Q298*; 10:89710721-89710721

endometriumcarcinoma; endometrioid_carcinoma

c.94_96delATT; p.I32del; 10:89643776-89643778

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.209_209+1delTg; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.1027-1G>A; p.?; 10:89715023-89715023

endometriumcarcinoma; endometrioid_carcinoma

c.601G>T; p.E201*;

endometriumcarcinoma; endometrioid_carcinoma

c.900C>T; p.I300I;

endometriumcarcinoma; endometrioid_carcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.48_49delTC; p.Y16fs*1; 10:89614254-89614255

endometriumcarcinoma; endometrioid_carcinoma

c.449_450insGGCCCTAG; p.D153fs*3;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.801+2T>C; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.275A>G; p.D92G; 10:89682771-89682771

endometriumcarcinoma; endometrioid_carcinoma

c.448G>T; p.E150*;

endometriumcarcinoma; endometrioid_carcinoma

c.210-2A>G; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.514delA; p.R172fs*11;

endometriumcarcinoma; endometrioid_carcinoma

c.901delG; p.D301fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.424C>T; p.R142W; 10:89682920-89682920

endometriumcarcinoma; endometrioid_carcinoma

c.809T>C; p.M270T;

endometriumcarcinoma; endometrioid_carcinoma

c.18A>G; p.K6K;

large_intestine; coloncarcinoma; adenocarcinoma

c.514A>G; p.R172G;

large_intestine; coloncarcinoma; adenocarcinoma

c.973C>T; p.L325F;

large_intestine; coloncarcinoma; adenocarcinoma

c.2T>C; p.M1T; 10:89614208-89614208

large_intestine; coloncarcinoma; adenocarcinoma

c.324T>C; p.L108L;

large_intestine; coloncarcinoma; adenocarcinoma

c.339T>C; p.S113S;

large_intestine; coloncarcinoma; adenocarcinoma

c.821G>T; p.W274L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.109T>C; p.F37L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.829A>T; p.T277S;

large_intestine; caecumcarcinoma; adenocarcinoma

c.859T>C; p.S287P;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1026+2T>C; p.?;

large_intestine; caecumcarcinoma; adenocarcinoma

c.517C>T; p.R173C; 10:89701879-89701879

large_intestine; caecumcarcinoma; adenocarcinoma

c.393T>C; p.T131T;

large_intestine; coloncarcinoma; adenocarcinoma

c.341A>G; p.E114G;

large_intestine; coloncarcinoma; adenocarcinoma

c.356T>C; p.V119A;

large_intestine; coloncarcinoma; adenocarcinoma

c.758T>C; p.I253T;

large_intestine; coloncarcinoma; adenocarcinoma

c.871G>A; p.E291K; 10:89710700-89710700

large_intestine; caecumcarcinoma; adenocarcinoma

c.161T>C; p.V54A;

large_intestine; caecumcarcinoma; adenocarcinoma

c.665T>C; p.V222A; 10:89707620-89707620

large_intestine; caecumcarcinoma; adenocarcinoma

c.615G>A; p.M205I; 10:89701977-89701977

large_intestine; caecumcarcinoma; adenocarcinoma

c.323T>C; p.L108P;

large_intestine; caecumcarcinoma; adenocarcinoma

c.454C>T; p.L152L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.480C>A; p.T160T;

large_intestine; caecumcarcinoma; adenocarcinoma

c.567A>G; p.R189R;

large_intestine; caecumcarcinoma; adenocarcinoma

c.959T>C; p.L320S;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1030A>G; p.K344E;

large_intestine; caecumcarcinoma; adenocarcinoma

c.449A>G; p.E150G; 10:89682945-89682945

large_intestine; caecumcarcinoma; adenocarcinoma

c.8C>T; p.A3V;

large_intestine; caecumcarcinoma; adenocarcinoma

c.162A>G; p.V54V;

large_intestine; caecumcarcinoma; adenocarcinoma

c.334C>A; p.L112I;

large_intestine; caecumcarcinoma; adenocarcinoma

c.440A>T; p.K147M;

large_intestine; caecumcarcinoma; adenocarcinoma

c.759C>A; p.I253I;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.30C>T; p.S10S;

large_intestine; coloncarcinoma; adenocarcinoma

c.29G>T; p.S10I;

large_intestine; coloncarcinoma; adenocarcinoma

c.422A>G; p.H141R;

large_intestine; coloncarcinoma; adenocarcinoma

c.612A>G; p.P204P;

large_intestine; coloncarcinoma; adenocarcinoma

c.1090T>C; p.S364P;

large_intestine; coloncarcinoma; adenocarcinoma

c.444A>G; p.A148A;

large_intestine; coloncarcinoma; adenocarcinoma

c.878G>T; p.G293V;

large_intestine; coloncarcinoma; adenocarcinoma

c.139A>G; p.R47G; 10:89643821-89643821

large_intestine; coloncarcinoma; adenocarcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

large_intestine; coloncarcinoma; adenocarcinoma

c.829A>G; p.T277A;

large_intestine; caecumcarcinoma; adenocarcinoma

c.272A>G; p.E91G;

large_intestine; coloncarcinoma; adenocarcinoma

c.337A>G; p.S113G;

large_intestine; coloncarcinoma; adenocarcinoma

c.421C>A; p.H141N;

large_intestine; coloncarcinoma; adenocarcinoma

c.1027-1G>A; p.?; 10:89715023-89715023

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.974T>G; p.L325R;

endometriumcarcinoma; endometrioid_carcinoma

c.380G>T; p.G127V; 10:89682876-89682876

endometriumcarcinoma; endometrioid_carcinoma

c.419T>G; p.L140*;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.286C>A; p.P96T;

endometriumcarcinoma; endometrioid_carcinoma

c.19G>T; p.E7*; 10:89614225-89614225

endometriumcarcinoma; endometrioid_carcinoma

c.382A>C; p.K128Q;

endometriumcarcinoma; endometrioid_carcinoma

c.140G>T; p.R47M;

endometriumcarcinoma; endometrioid_carcinoma

c.433T>A; p.F145I; 10:89682929-89682929

endometriumcarcinoma; endometrioid_carcinoma

c.376G>T; p.A126S; 10:89682872-89682872

endometriumcarcinoma; endometrioid_carcinoma

c.1027-1G>A; p.?; 10:89715023-89715023

endometriumcarcinoma; endometrioid_carcinoma

c.968A>C; p.N323T;

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.517C>T; p.R173C; 10:89701879-89701879

endometriumcarcinoma; endometrioid_carcinoma

c.98T>G; p.I33S; 10:89643780-89643780

endometriumcarcinoma; endometrioid_carcinoma

c.413A>G; p.Y138C; 10:89682909-89682909

endometriumcarcinoma; endometrioid_carcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

endometriumcarcinoma; endometrioid_carcinoma

c.922delC; p.R308fs*9;

endometriumcarcinoma; endometrioid_carcinoma

c.448G>T; p.E150*;

endometriumcarcinoma; endometrioid_carcinoma

c.203A>G; p.Y68C; 10:89675288-89675288

endometriumcarcinoma; endometrioid_carcinoma

c.895G>T; p.E299*; 10:89710724-89710724

endometriumcarcinoma; endometrioid_carcinoma

c.32G>A; p.R11K;

endometriumcarcinoma; endometrioid_carcinoma

c.738G>A; p.P246P;

endometriumcarcinoma; endometrioid_carcinoma

c.722T>C; p.F241S; 10:89707677-89707677

endometriumcarcinoma; endometrioid_carcinoma

c.526_528delTAT; p.Y176del; 10:89701888-89701890

endometriumcarcinoma; endometrioid_carcinoma

c.606_607delTA; p.I203fs*39;

endometriumcarcinoma; endometrioid_carcinoma

c.71A>G; p.D24G; 10:89614277-89614277

endometriumcarcinoma; endometrioid_carcinoma

c.195C>G; p.Y65*; 10:89675280-89675280

endometriumcarcinoma; endometrioid_carcinoma

c.493G>A; p.G165R; 10:89701855-89701855

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.1021T>G; p.F341V; 10:89710850-89710850

endometriumcarcinoma; endometrioid_carcinoma

c.19G>T; p.E7*; 10:89614225-89614225

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.68_71delTAGA; p.L23fs*2;

endometriumcarcinoma; endometrioid_carcinoma

c.740_741insA; p.P248fs*5;

endometriumcarcinoma; endometrioid_carcinoma

c.493G>A; p.G165R; 10:89701855-89701855

endometriumcarcinoma; endometrioid_carcinoma

c.389G>T; p.R130L; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.1016_1017insA; p.N340fs*3;

endometriumcarcinoma; endometrioid_carcinoma

c.23delT; p.I8fs*16;

endometriumcarcinoma; endometrioid_carcinoma

c.740_741insA; p.P248fs*5;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.493-2A>G; p.?; 10:89701853-89701853

breastcarcinoma

c.278A>T; p.H93L;

breastcarcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

breastcarcinoma

c.142delA; p.N48fs*6;

breastcarcinoma

c.796A>T; p.K266*;

breastcarcinoma

c.787A>T; p.K263*; 10:89707742-89707742

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.276_291del16; p.H93fs*1;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.140delG; p.N48fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.952_953insT; p.T319fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.445C>T; p.Q149*; 10:89682941-89682941

endometriumcarcinoma; endometrioid_carcinoma

c.461T>G; p.F154C;

endometriumcarcinoma; endometrioid_carcinoma

c.155delA; p.D52fs*2;

endometriumcarcinoma; endometrioid_carcinoma

c.1026G>T; p.K342N;

endometriumcarcinoma; endometrioid_carcinoma

c.212G>A; p.C71Y; 10:89680785-89680785

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.1106delT; p.S370fs*>34;

endometriumcarcinoma; endometrioid_carcinoma

c.282delC; p.P95fs*4;

endometriumcarcinoma; endometrioid_carcinoma

c.619delA; p.S207fs*14;

endometriumcarcinoma; endometrioid_carcinoma

c.28_30delAGC; p.S10delS;

endometriumcarcinoma; endometrioid_carcinoma

c.635-1G>C; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.276C>G; p.D92E;

endometriumcarcinoma; endometrioid_carcinoma

c.956_959delCTTT; p.T319fs*24; 10:89710785-89710788

endometriumcarcinoma; endometrioid_carcinoma

c.635-1G>A; p.?; 10:89707589-89707589

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.808_812delATGTT; p.M270fs*26;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.258delA; p.Q87fs*12;

endometriumcarcinoma; endometrioid_carcinoma

c.260A>C; p.Q87P;

endometriumcarcinoma; endometrioid_carcinoma

c.634_634+3delAgta; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.956_959delCTTT; p.T319fs*24; 10:89710785-89710788

endometriumcarcinoma; endometrioid_carcinoma

c.870delA; p.E291fs*16;

endometriumcarcinoma; endometrioid_carcinoma

c.400_402delATG; p.M134delM;

endometriumcarcinoma; endometrioid_carcinoma

c.470_473delAAGT; p.V158fs*8;

endometriumcarcinoma; endometrioid_carcinoma

c.480C>G; p.T160T;

endometriumcarcinoma; endometrioid_carcinoma

c.935delA; p.D312fs*5;

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.209+2delt; p.?;

breastcarcinoma

c.254-22_269del38; p.?;

breastcarcinoma

c.389G>C; p.R130P; 10:89682885-89682885

breastcarcinoma

c.634+2T>C; p.?;

breastcarcinoma

c.143A>T; p.N48I; 10:89643825-89643825

breastcarcinoma

c.460_492+5del38; p.?;

breastcarcinoma

c.640C>T; p.Q214*; 10:89707595-89707595

cervixcarcinoma; squamous_cell_carcinoma

c.379G>A; p.G127R; 10:89682875-89682875

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.919_922delGAGC; p.E307fs*9;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.271G>T; p.E91*; 10:89682767-89682767

endometriumcarcinoma; endometrioid_carcinoma

c.802-1G>A; p.?; 10:89710630-89710630

endometriumcarcinoma; endometrioid_carcinoma

c.1027-2A>G; p.?; 10:89715022-89715022

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.624C>T; p.G208G;

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.457G>T; p.D153Y; 10:89682953-89682953

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.828T>G; p.N276K;

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.892C>T; p.Q298*; 10:89710721-89710721

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.386G>T; p.G129V; 10:89682882-89682882

endometriumcarcinoma; endometrioid_carcinoma

c.437T>G; p.L146*;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.984_987delAAAT; p.A328fs*15; 10:89710813-89710816

endometriumcarcinoma; endometrioid_carcinoma

c.746T>A; p.V249E;

endometriumcarcinoma; endometrioid_carcinoma

c.455T>C; p.L152P;

endometriumcarcinoma; endometrioid_carcinoma

c.459T>A; p.D153E;

endometriumcarcinoma; endometrioid_carcinoma

c.118G>T; p.E40*; 10:89643800-89643800

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.1026+1G>A; p.?; 10:89710856-89710856

endometriumcarcinoma; endometrioid_carcinoma

c.388C>T; p.R130*; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.117_120delAGAA; p.E40fs*13;

endometriumcarcinoma; endometrioid_carcinoma

c.469G>T; p.E157*;

endometriumcarcinoma; endometrioid_carcinoma

c.644T>C; p.F215S;

endometriumcarcinoma; endometrioid_carcinoma

c.900C>T; p.I300I;

endometriumcarcinoma; endometrioid_carcinoma

c.93C>G; p.N31K;

endometriumcarcinoma; endometrioid_carcinoma

c.631_632insG; p.C211fs*32;

endometriumcarcinoma; endometrioid_carcinoma

c.937delA; p.K313fs*4;

endometriumcarcinoma; endometrioid_carcinoma

c.900C>T; p.I300I;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.407G>T; p.C136F; 10:89682903-89682903

endometriumcarcinoma; endometrioid_carcinoma

c.101C>T; p.A34V;

endometriumcarcinoma; endometrioid_carcinoma

c.133delG; p.V45fs*9;

endometriumcarcinoma; endometrioid_carcinoma

c.395G>A; p.G132D; 10:89682891-89682891

endometriumcarcinoma; endometrioid_carcinoma

c.543_544insT; p.L182fs*8;

endometriumcarcinoma; endometrioid_carcinoma

c.414T>C; p.Y138Y;

large_intestine; coloncarcinoma; adenocarcinoma

c.424C>T; p.R142W; 10:89682920-89682920

large_intestine; coloncarcinoma; adenocarcinoma

c.341A>G; p.E114G;

large_intestine; coloncarcinoma; adenocarcinoma

c.1030A>G; p.K344E;

large_intestine; coloncarcinoma; adenocarcinoma

c.268T>C; p.F90L;

large_intestine; coloncarcinoma; adenocarcinoma

c.366T>C; p.I122I;

large_intestine; coloncarcinoma; adenocarcinoma

c.273A>G; p.E91E;

large_intestine; coloncarcinoma; adenocarcinoma

c.912C>T; p.C304C;

large_intestine; coloncarcinoma; adenocarcinoma

c.347A>G; p.D116G; 10:89682843-89682843

large_intestine; coloncarcinoma; adenocarcinoma

c.275A>G; p.D92G; 10:89682771-89682771

large_intestine; coloncarcinoma; adenocarcinoma

c.321T>C; p.D107D;

large_intestine; coloncarcinoma; adenocarcinoma

c.333G>A; p.W111*; 10:89682829-89682829

large_intestine; coloncarcinoma; adenocarcinoma

c.912C>T; p.C304C;

large_intestine; coloncarcinoma; adenocarcinoma

c.1006T>C; p.Y336H;

large_intestine; coloncarcinoma; adenocarcinoma

c.340G>T; p.E114*; 10:89682836-89682836

large_intestine; coloncarcinoma; adenocarcinoma

c.355G>T; p.V119F; 10:89682851-89682851

prostatecarcinoma; adenocarcinoma

c.977A>G; p.D326G; 10:89710806-89710806

prostatecarcinoma; adenocarcinoma

c.210-1G>A; p.?;

prostatecarcinoma; adenocarcinoma

c.79T>C; p.Y27H;

large_intestine; rectumcarcinoma; adenocarcinoma

c.927A>C; p.A309A; 10:89710756-89710756

large_intestine; rectumcarcinoma; adenocarcinoma

c.641A>G; p.Q214R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.395G>T; p.G132V; 10:89682891-89682891

large_intestine; rectumcarcinoma; adenocarcinoma

c.1194A>G; p.T398T;

large_intestine; rectumcarcinoma; adenocarcinoma

c.263A>G; p.Y88C; 10:89682759-89682759

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.117A>G; p.A39A;

large_intestine; coloncarcinoma; adenocarcinoma

c.142A>G; p.N48D; 10:89643824-89643824

large_intestine; coloncarcinoma; adenocarcinoma

c.705A>G; p.E235E;

large_intestine; coloncarcinoma; adenocarcinoma

c.700C>T; p.R234W; 10:89707655-89707655

large_intestine; coloncarcinoma; adenocarcinoma

c.309C>A; p.P103P;

large_intestine; coloncarcinoma; adenocarcinoma

c.821G>T; p.W274L;

large_intestine; coloncarcinoma; adenocarcinoma

c.256G>T; p.A86S;

large_intestine; coloncarcinoma; adenocarcinoma

c.375A>G; p.K125K;

large_intestine; coloncarcinoma; adenocarcinoma

c.687A>T; p.S229S;

large_intestine; coloncarcinoma; adenocarcinoma

c.897A>T; p.E299D;

large_intestine; coloncarcinoma; adenocarcinoma

c.286C>T; p.P96S; 10:89682782-89682782

large_intestine; coloncarcinoma; adenocarcinoma

c.483A>G; p.R161R;

large_intestine; coloncarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; coloncarcinoma; adenocarcinoma

c.281A>G; p.N94S;

large_intestine; caecumcarcinoma; adenocarcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

large_intestine; caecumcarcinoma; adenocarcinoma

c.801+1G>T; p.?; 10:89707757-89707757

large_intestine; caecumcarcinoma; adenocarcinoma

c.117A>G; p.A39A;

large_intestine; coloncarcinoma; adenocarcinoma

c.341A>G; p.E114G;

large_intestine; coloncarcinoma; adenocarcinoma

c.1043C>A; p.T348K;

large_intestine; coloncarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; coloncarcinoma; adenocarcinoma

c.539A>G; p.Y180C;

large_intestine; coloncarcinoma; adenocarcinoma

c.679T>C; p.S227P;

large_intestine; coloncarcinoma; adenocarcinoma

c.813T>C; p.F271F;

large_intestine; coloncarcinoma; adenocarcinoma

c.40A>G; p.R14G; 10:89614246-89614246

large_intestine; coloncarcinoma; adenocarcinoma

c.1106T>C; p.V369A;

large_intestine; caecumcarcinoma; adenocarcinoma

c.920A>G; p.E307G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.712T>C; p.F238L; 10:89707667-89707667

large_intestine; caecumcarcinoma; adenocarcinoma

c.391A>G; p.T131A; 10:89682887-89682887

large_intestine; coloncarcinoma; adenocarcinoma

c.1146C>T; p.T382T;

large_intestine; caecumcarcinoma; adenocarcinoma

c.713T>C; p.F238S;

large_intestine; rectumcarcinoma; adenocarcinoma

c.53A>G; p.E18G;

large_intestine; rectumcarcinoma; adenocarcinoma

c.80-1G>T; p.?;

large_intestine; coloncarcinoma; adenocarcinoma

c.275A>G; p.D92G; 10:89682771-89682771

large_intestine; coloncarcinoma; adenocarcinoma

c.383A>G; p.K128R;

large_intestine; caecumcarcinoma; adenocarcinoma

c.851A>G; p.E284G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.417A>T; p.L139F;

large_intestine; coloncarcinoma; adenocarcinoma

c.896A>G; p.E299G;

large_intestine; coloncarcinoma; adenocarcinoma

c.284C>T; p.P95L; 10:89682780-89682780

large_intestine; coloncarcinoma; adenocarcinoma

c.108A>G; p.G36G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.851A>G; p.E284G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.155A>G; p.D52G; 10:89643837-89643837

large_intestine; caecumcarcinoma; adenocarcinoma

c.490A>G; p.K164E;

large_intestine; caecumcarcinoma; adenocarcinoma

c.567A>G; p.R189R;

large_intestine; caecumcarcinoma; adenocarcinoma

c.813T>C; p.F271F;

large_intestine; caecumcarcinoma; adenocarcinoma

c.871G>T; p.E291*; 10:89710700-89710700

large_intestine; caecumcarcinoma; adenocarcinoma

c.533A>T; p.Y178F;

large_intestine; coloncarcinoma; adenocarcinoma

c.812T>C; p.F271S; 10:89710641-89710641

large_intestine; coloncarcinoma; adenocarcinoma

c.324T>C; p.L108L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.483A>G; p.R161R;

large_intestine; caecumcarcinoma; adenocarcinoma

c.275A>G; p.D92G; 10:89682771-89682771

large_intestine; caecumcarcinoma; adenocarcinoma

c.13A>G; p.I5V;

large_intestine; coloncarcinoma; adenocarcinoma

c.927A>G; p.A309A;

large_intestine; coloncarcinoma; adenocarcinoma

c.159A>G; p.V53V;

large_intestine; caecumcarcinoma; adenocarcinoma

c.243T>A; p.F81L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.323T>C; p.L108P;

large_intestine; coloncarcinoma; adenocarcinoma

c.387A>G; p.G129G;

large_intestine; coloncarcinoma; adenocarcinoma

c.114T>C; p.P38P;

large_intestine; coloncarcinoma; adenocarcinoma

c.788A>G; p.K263R;

large_intestine; coloncarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; coloncarcinoma; adenocarcinoma

c.962_963insA; p.N323fs*2; 10:89710791-89710792

large_intestine; coloncarcinoma; adenocarcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

large_intestine; coloncarcinoma; adenocarcinoma

c.721T>C; p.F241L; 10:89707676-89707676

large_intestine; coloncarcinoma; adenocarcinoma

c.969T>A; p.N323K; 10:89710798-89710798

large_intestine; coloncarcinoma; adenocarcinoma

c.485A>G; p.D162G; 10:89682981-89682981

large_intestine; coloncarcinoma; adenocarcinoma

c.851A>G; p.E284G;

large_intestine; coloncarcinoma; adenocarcinoma

c.850G>T; p.E284*; 10:89710679-89710679

large_intestine; coloncarcinoma; adenocarcinoma

c.647T>C; p.V216A;

large_intestine; coloncarcinoma; adenocarcinoma

c.665T>C; p.V222A; 10:89707620-89707620

large_intestine; coloncarcinoma; adenocarcinoma

c.341A>G; p.E114G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.383A>G; p.K128R;

large_intestine; caecumcarcinoma; adenocarcinoma

c.405A>G; p.I135M; 10:89682901-89682901

large_intestine; caecumcarcinoma; adenocarcinoma

c.851A>G; p.E284G;

large_intestine; coloncarcinoma; adenocarcinoma

c.927A>G; p.A309A;

large_intestine; coloncarcinoma; adenocarcinoma

c.449A>G; p.E150G; 10:89682945-89682945

large_intestine; coloncarcinoma; adenocarcinoma

c.333G>A; p.W111*; 10:89682829-89682829

large_intestine; caecumcarcinoma; adenocarcinoma

c.365T>C; p.I122T;

large_intestine; coloncarcinoma; adenocarcinoma

c.538T>A; p.Y180N;

large_intestine; coloncarcinoma; adenocarcinoma

c.910T>C; p.C304R;

large_intestine; coloncarcinoma; adenocarcinoma

c.315T>C; p.C105C;

large_intestine; coloncarcinoma; adenocarcinoma

c.811T>C; p.F271L;

large_intestine; coloncarcinoma; adenocarcinoma

c.654C>A; p.C218*; 10:89707609-89707609

large_intestine; coloncarcinoma; adenocarcinoma

c.156T>C; p.D52D;

large_intestine; coloncarcinoma; adenocarcinoma

c.492G>T; p.K164N;

large_intestine; coloncarcinoma; adenocarcinoma

c.504T>C; p.I168I;

large_intestine; coloncarcinoma; adenocarcinoma

c.977A>G; p.D326G; 10:89710806-89710806

large_intestine; coloncarcinoma; adenocarcinoma

c.168T>C; p.F56F;

large_intestine; coloncarcinoma; adenocarcinoma

c.366T>C; p.I122I;

large_intestine; coloncarcinoma; adenocarcinoma

c.812T>C; p.F271S; 10:89710641-89710641

large_intestine; caecumcarcinoma; adenocarcinoma

c.156T>C; p.D52D;

large_intestine; coloncarcinoma; adenocarcinoma

c.743C>T; p.P248L;

large_intestine; coloncarcinoma; adenocarcinoma

c.859T>C; p.S287P;

large_intestine; coloncarcinoma; adenocarcinoma

c.1144A>G; p.T382A;

large_intestine; coloncarcinoma; adenocarcinoma

c.355G>A; p.V119I;

large_intestine; coloncarcinoma; adenocarcinoma

c.156T>C; p.D52D;

large_intestine; caecumcarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.778A>T; p.K260*;

endometriumcarcinoma; endometrioid_carcinoma

c.900delC; p.I300fs*7;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.764T>G; p.V255G;

endometriumcarcinoma; endometrioid_carcinoma

c.979delA; p.A328fs*16;

endometriumcarcinoma; endometrioid_carcinoma

c.493G>A; p.G165R; 10:89701855-89701855

endometriumcarcinoma; endometrioid_carcinoma

c.1008C>G; p.Y336*; 10:89710837-89710837

endometriumcarcinoma; endometrioid_carcinoma

c.762_764delAGT; p.V255delV;

endometriumcarcinoma; endometrioid_carcinoma

c.1003C>T; p.R335*; 10:89710832-89710832

endometriumcarcinoma; endometrioid_carcinoma

c.19G>T; p.E7*; 10:89614225-89614225

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.200T>C; p.I67T;

endometriumcarcinoma; endometrioid_carcinoma

c.582_583insT; p.H196fs*6;

endometriumcarcinoma; endometrioid_carcinoma

c.778_779delAA; p.K260fs*37;

endometriumcarcinoma; endometrioid_carcinoma

c.437T>A; p.L146*;

endometriumcarcinoma; endometrioid_carcinoma

c.902_906delATAGC; p.S302fs*8;

endometriumcarcinoma; endometrioid_carcinoma

c.334C>G; p.L112V; 10:89682830-89682830

endometriumcarcinoma; endometrioid_carcinoma

c.782_783delAG; p.N262fs*35;

endometriumcarcinoma; endometrioid_carcinoma

c.389G>C; p.R130P; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.979delA; p.A328fs*16;

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.1030delA; p.K344fs*8;

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.207_208delTC; p.A72fs*1;

endometriumcarcinoma; endometrioid_carcinoma

c.367C>G; p.H123D;

endometriumcarcinoma; endometrioid_carcinoma

c.821G>A; p.W274*; 10:89710650-89710650

endometriumcarcinoma; endometrioid_carcinoma

c.626_627insA; p.T210fs*33;

endometriumcarcinoma; endometrioid_carcinoma

c.419T>G; p.L140*;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.464A>G; p.Y155C; 10:89682960-89682960

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.407G>T; p.C136F; 10:89682903-89682903

endometriumcarcinoma; endometrioid_carcinoma

c.370T>C; p.C124R;

endometriumcarcinoma; endometrioid_carcinoma

c.503_504insG; p.I168fs*12;

endometriumcarcinoma; endometrioid_carcinoma

c.505_508delCCCA; p.P169fs*13;

endometriumcarcinoma; endometrioid_carcinoma

c.601G>T; p.E201*;

endometriumcarcinoma; endometrioid_carcinoma

c.259C>T; p.Q87*; 10:89682755-89682755

endometriumcarcinoma; endometrioid_carcinoma

c.431A>C; p.K144T;

endometriumcarcinoma; endometrioid_carcinoma

c.629delC; p.T210fs*11;

endometriumcarcinoma; endometrioid_carcinoma

c.386G>T; p.G129V; 10:89682882-89682882

endometriumcarcinoma; endometrioid_carcinoma

c.389G>A; p.R130Q; 10:89682885-89682885

endometriumcarcinoma; endometrioid_carcinoma

c.469G>T; p.E157*;

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.48T>G; p.Y16*;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.720C>G; p.Y240*;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.218delA; p.R74fs*25;

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.697C>T; p.R233*; 10:89707652-89707652

endometriumcarcinoma; endometrioid_carcinoma

c.823G>T; p.V275L;

endometriumcarcinoma; endometrioid_carcinoma

c.79T>G; p.Y27D;

endometriumcarcinoma; endometrioid_carcinoma

c.119delA; p.R41fs*13;

endometriumcarcinoma; endometrioid_carcinoma

c.402G>C; p.M134I;

endometriumcarcinoma; endometrioid_carcinoma

c.89C>A; p.P30Q;

endometriumcarcinoma; endometrioid_carcinoma

c.210-1G>A; p.?;

endometriumcarcinoma; endometrioid_carcinoma

c.263_272del10; p.Y88fs*1;

endometriumcarcinoma; endometrioid_carcinoma

c.584_585insTC; p.H196fs*4;

endometriumcarcinoma; endometrioid_carcinoma

c.950_953delTACT; p.L318fs*2; 10:89710779-89710782

endometriumcarcinoma; endometrioid_carcinoma

c.388C>G; p.R130G; 10:89682884-89682884

endometriumcarcinoma; endometrioid_carcinoma

c.634+1G>T; p.?; 10:89701997-89701997

endometriumcarcinoma; endometrioid_carcinoma

c.348C>T; p.D116D;

large_intestine; caecumcarcinoma; adenocarcinoma

c.106G>T; p.G36*; 10:89643788-89643788

large_intestine; coloncarcinoma; adenocarcinoma

c.974T>G; p.L325R;

large_intestine; coloncarcinoma; adenocarcinoma

c.132C>T; p.G44G; 10:89643814-89643814

large_intestine; caecumcarcinoma; adenocarcinoma

c.851A>G; p.E284G;

large_intestine; coloncarcinoma; adenocarcinoma

c.163A>G; p.R55G; 10:89643845-89643845

large_intestine; coloncarcinoma; adenocarcinoma

c.355G>A; p.V119I;

large_intestine; caecumcarcinoma; adenocarcinoma

c.519C>T; p.R173R; 10:89701881-89701881

large_intestine; caecumcarcinoma; adenocarcinoma

c.365T>C; p.I122T;

large_intestine; coloncarcinoma; adenocarcinoma

c.114T>C; p.P38P;

large_intestine; coloncarcinoma; adenocarcinoma

c.342A>G; p.E114E;

large_intestine; coloncarcinoma; adenocarcinoma

c.356T>C; p.V119A;

large_intestine; coloncarcinoma; adenocarcinoma

c.721T>C; p.F241L; 10:89707676-89707676

large_intestine; coloncarcinoma; adenocarcinoma

c.449A>G; p.E150G; 10:89682945-89682945

large_intestine; coloncarcinoma; adenocarcinoma

c.342A>G; p.E114E;

large_intestine; coloncarcinoma; adenocarcinoma

c.825A>T; p.V275V;

large_intestine; coloncarcinoma; adenocarcinoma

c.1191T>A; p.H397Q;

large_intestine; coloncarcinoma; adenocarcinoma

c.546A>T; p.L182F; 10:89701908-89701908

large_intestine; coloncarcinoma; adenocarcinoma

c.56A>G; p.D19G;

large_intestine; coloncarcinoma; adenocarcinoma

c.44G>A; p.R15K; 10:89614250-89614250

large_intestine; coloncarcinoma; adenocarcinoma

c.335T>C; p.L112P; 10:89682831-89682831

large_intestine; coloncarcinoma; adenocarcinoma

c.701G>T; p.R234L;

large_intestine; coloncarcinoma; adenocarcinoma

c.341A>G; p.E114G;

large_intestine; coloncarcinoma; adenocarcinoma

c.396T>C; p.G132G;

large_intestine; coloncarcinoma; adenocarcinoma

c.974T>A; p.L325H;

large_intestine; coloncarcinoma; adenocarcinoma

c.424C>T; p.R142W; 10:89682920-89682920

large_intestine; coloncarcinoma; adenocarcinoma

c.287C>T; p.P96L; 10:89682783-89682783

large_intestine; coloncarcinoma; adenocarcinoma

c.275A>G; p.D92G; 10:89682771-89682771

large_intestine; coloncarcinoma; adenocarcinoma

c.407G>T; p.C136F; 10:89682903-89682903

large_intestine; coloncarcinoma; adenocarcinoma

c.157G>A; p.V53I;

large_intestine; caecumcarcinoma; adenocarcinoma

c.256G>T; p.A86S;

large_intestine; caecumcarcinoma; adenocarcinoma

c.118G>T; p.E40*; 10:89643800-89643800

large_intestine; coloncarcinoma; adenocarcinoma

c.117A>G; p.A39A;

large_intestine; coloncarcinoma; adenocarcinoma

c.974T>C; p.L325P; 10:89710803-89710803

large_intestine; coloncarcinoma; adenocarcinoma

c.328C>A; p.Q110K;

large_intestine; coloncarcinoma; adenocarcinoma

c.337A>G; p.S113G;

large_intestine; coloncarcinoma; adenocarcinoma

c.483A>G; p.R161R;

large_intestine; coloncarcinoma; adenocarcinoma

c.347A>G; p.D116G; 10:89682843-89682843

large_intestine; coloncarcinoma; adenocarcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

large_intestine; coloncarcinoma; adenocarcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

large_intestine; coloncarcinoma; adenocarcinoma

c.45A>G; p.R15R;

large_intestine; coloncarcinoma; adenocarcinoma

c.687A>G; p.S229S;

large_intestine; coloncarcinoma; adenocarcinoma

c.331T>C; p.W111R; 10:89682827-89682827

large_intestine; coloncarcinoma; adenocarcinoma

c.104T>C; p.M35T;

large_intestine; coloncarcinoma; adenocarcinoma

c.705A>G; p.E235E;

large_intestine; coloncarcinoma; adenocarcinoma

c.45A>G; p.R15R;

large_intestine; coloncarcinoma; adenocarcinoma

c.315T>C; p.C105C;

large_intestine; coloncarcinoma; adenocarcinoma

c.387A>G; p.G129G;

large_intestine; coloncarcinoma; adenocarcinoma

c.356T>C; p.V119A;

large_intestine; coloncarcinoma; adenocarcinoma

c.368A>G; p.H123R;

large_intestine; coloncarcinoma; adenocarcinoma

c.679T>C; p.S227P;

large_intestine; caecumcarcinoma; adenocarcinoma

c.139A>G; p.R47G; 10:89643821-89643821

large_intestine; caecumcarcinoma; adenocarcinoma

c.767_768insG; p.F257fs*41;

breastcarcinoma

c.46_47insA; p.Y16fs*1;

breastcarcinoma

c.45_46insT; p.R15fs*28; 10:89614251-89614252

breastcarcinoma

c.590A>G; p.K197R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.227A>G; p.Y76C;

large_intestine; rectumcarcinoma; adenocarcinoma

c.1000A>G; p.N334D;

large_intestine; rectumcarcinoma; adenocarcinoma

c.260A>G; p.Q87R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.9C>T; p.A3A;

large_intestine; rectumcarcinoma; adenocarcinoma

c.487A>G; p.K163E;

large_intestine; rectumcarcinoma; adenocarcinoma

c.334C>T; p.L112L;

large_intestine; rectumcarcinoma; adenocarcinoma

c.63C>T; p.F21F;

large_intestine; rectumcarcinoma; adenocarcinoma

c.281A>G; p.N94S;

large_intestine; rectumcarcinoma; adenocarcinoma

c.543G>A; p.L181L;

large_intestine; rectumcarcinoma; adenocarcinoma

c.1027-1G>T; p.?;

large_intestine; rectumcarcinoma; adenocarcinoma

c.698G>A; p.R233Q;

urinary_tract; bladdercarcinoma

c.817T>C; p.F273L;

large_intestine; caecumcarcinoma; adenocarcinoma

c.58G>A; p.G20R;

large_intestine; coloncarcinoma; adenocarcinoma

c.770T>C; p.F257S;

large_intestine; caecumcarcinoma; adenocarcinoma

c.924T>A; p.R308R;

large_intestine; caecumcarcinoma; adenocarcinoma

c.158T>C; p.V53A; 10:89643840-89643840

large_intestine; caecumcarcinoma; adenocarcinoma

c.425G>T; p.R142L;

large_intestine; coloncarcinoma; adenocarcinoma

c.444A>G; p.A148A;

large_intestine; coloncarcinoma; adenocarcinoma

c.953T>C; p.L318P;

large_intestine; coloncarcinoma; adenocarcinoma

c.449A>G; p.E150G; 10:89682945-89682945

large_intestine; coloncarcinoma; adenocarcinoma

c.421C>A; p.H141N;

large_intestine; caecumcarcinoma; adenocarcinoma

c.481_482delAG; p.D162fs*17;

large_intestine; caecumcarcinoma; adenocarcinoma

c.665T>C; p.V222A; 10:89707620-89707620

large_intestine; caecumcarcinoma; adenocarcinoma

c.484G>C; p.D162H; 10:89682980-89682980

large_intestine; caecumcarcinoma; adenocarcinoma

c.329A>G; p.Q110R;

large_intestine; coloncarcinoma; adenocarcinoma

c.404T>C; p.I135T;

large_intestine; coloncarcinoma; adenocarcinoma

c.275A>G; p.D92G; 10:89682771-89682771

large_intestine; coloncarcinoma; adenocarcinoma

c.19G>T; p.E7*; 10:89614225-89614225

large_intestine; coloncarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; coloncarcinoma; adenocarcinoma

c.1031A>G; p.K344R; 10:89715028-89715028

large_intestine; coloncarcinoma; adenocarcinoma

c.992A>G; p.D331G; 10:89710821-89710821

large_intestine; coloncarcinoma; adenocarcinoma

c.164G>T; p.R55M;

large_intestine; coloncarcinoma; adenocarcinoma

c.1014T>C; p.S338S;

large_intestine; coloncarcinoma; adenocarcinoma

c.862G>T; p.E288*; 10:89710691-89710691

large_intestine; coloncarcinoma; adenocarcinoma

c.860C>T; p.S287L;

large_intestine; coloncarcinoma; adenocarcinoma

c.1025A>G; p.K342R;

large_intestine; coloncarcinoma; adenocarcinoma

c.51A>G; p.Q17Q;

large_intestine; coloncarcinoma; adenocarcinoma

c.324T>C; p.L108L;

large_intestine; coloncarcinoma; adenocarcinoma

c.368A>G; p.H123R;

large_intestine; coloncarcinoma; adenocarcinoma

c.418T>C; p.L140L;

large_intestine; coloncarcinoma; adenocarcinoma

c.1025A>G; p.K342R;

large_intestine; coloncarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; coloncarcinoma; adenocarcinoma

c.67T>C; p.L23L;

large_intestine; coloncarcinoma; adenocarcinoma

c.162A>T; p.V54V;

large_intestine; coloncarcinoma; adenocarcinoma

c.976G>T; p.D326Y;

large_intestine; coloncarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; coloncarcinoma; adenocarcinoma

c.1146C>A; p.T382T;

large_intestine; coloncarcinoma; adenocarcinoma

c.321T>C; p.D107D;

large_intestine; caecumcarcinoma; adenocarcinoma

c.468G>A; p.G156G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.365T>C; p.I122T;

large_intestine; coloncarcinoma; adenocarcinoma

c.483A>G; p.R161R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.71A>G; p.D24G; 10:89614277-89614277

large_intestine; rectumcarcinoma; adenocarcinoma

c.51A>G; p.Q17Q;

large_intestine; rectumcarcinoma; adenocarcinoma

c.140G>T; p.R47M;

large_intestine; rectumcarcinoma; adenocarcinoma

c.483A>G; p.R161R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.74T>C; p.L25S;

large_intestine; rectumcarcinoma; adenocarcinoma

c.851A>G; p.E284G;

large_intestine; rectumcarcinoma; adenocarcinoma

c.1031A>G; p.K344R; 10:89715028-89715028

large_intestine; rectumcarcinoma; adenocarcinoma

c.697C>T; p.R233*; 10:89707652-89707652

large_intestine; rectumcarcinoma; adenocarcinoma

c.788A>G; p.K263R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.442G>T; p.A148S;

large_intestine; rectumcarcinoma; adenocarcinoma

c.752_762del11; p.D252fs*42;

breastcarcinoma

c.217_220delGAAA; p.E73fs*25;

breastcarcinoma

c.977_978delAC; p.D326fs*4;

breastcarcinoma

c.444A>G; p.A148A;

large_intestine; rectumcarcinoma; adenocarcinoma

c.394G>T; p.G132C;

large_intestine; rectumcarcinoma; adenocarcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

large_intestine; rectumcarcinoma; adenocarcinoma

c.408T>C; p.C136C;

large_intestine; rectumcarcinoma; adenocarcinoma

c.9C>T; p.A3A;

large_intestine; rectumcarcinoma; adenocarcinoma

c.1016C>T; p.P339L; 10:89710845-89710845

large_intestine; rectumcarcinoma; adenocarcinoma

c.288A>G; p.P96P;

large_intestine; rectumcarcinoma; adenocarcinoma

c.219A>G; p.E73E;

large_intestine; rectumcarcinoma; adenocarcinoma

c.758T>C; p.I253T;

large_intestine; rectumcarcinoma; adenocarcinoma

c.873A>G; p.E291E;

large_intestine; rectumcarcinoma; adenocarcinoma

c.438A>G; p.L146L;

large_intestine; coloncarcinoma; adenocarcinoma

c.879A>G; p.G293G;

large_intestine; coloncarcinoma; adenocarcinoma

c.1026+2T>C; p.?;

large_intestine; coloncarcinoma; adenocarcinoma

c.844G>T; p.G282*;

large_intestine; coloncarcinoma; adenocarcinoma

c.877G>A; p.G293R;

large_intestine; coloncarcinoma; adenocarcinoma

c.287C>T; p.P96L; 10:89682783-89682783

large_intestine; coloncarcinoma; adenocarcinoma

c.2T>C; p.M1T; 10:89614208-89614208

large_intestine; coloncarcinoma; adenocarcinoma

c.1036T>G; p.Y346D;

large_intestine; coloncarcinoma; adenocarcinoma

c.1194A>G; p.T398T;

large_intestine; coloncarcinoma; adenocarcinoma

c.370T>C; p.C124R;

large_intestine; coloncarcinoma; adenocarcinoma

c.1055A>G; p.E352G;

large_intestine; coloncarcinoma; adenocarcinoma

c.324T>C; p.L108L;

large_intestine; coloncarcinoma; adenocarcinoma

c.80A>G; p.Y27C; 10:89643762-89643762

large_intestine; coloncarcinoma; adenocarcinoma

c.635-1G>T; p.?; 10:89707589-89707589

large_intestine; coloncarcinoma; adenocarcinoma

c.1042A>G; p.T348A;

large_intestine; coloncarcinoma; adenocarcinoma

c.254T>C; p.V85A;

large_intestine; coloncarcinoma; adenocarcinoma

c.269T>G; p.F90C;

large_intestine; coloncarcinoma; adenocarcinoma

c.1030A>G; p.K344E;

large_intestine; coloncarcinoma; adenocarcinoma

c.40A>G; p.R14G; 10:89614246-89614246

large_intestine; coloncarcinoma; adenocarcinoma

c.422A>G; p.H141R;

large_intestine; coloncarcinoma; adenocarcinoma

c.328C>T; p.Q110*; 10:89682824-89682824

large_intestine; coloncarcinoma; adenocarcinoma

c.828T>A; p.N276K;

large_intestine; caecumcarcinoma; adenocarcinoma

c.16_17delAA; p.K6fs*4; 10:89614222-89614223

large_intestine; caecumcarcinoma; adenocarcinoma

c.387A>G; p.G129G;

large_intestine; rectumcarcinoma; adenocarcinoma

c.114T>C; p.P38P;

large_intestine; rectumcarcinoma; adenocarcinoma

c.879A>G; p.G293G;

large_intestine; rectumcarcinoma; adenocarcinoma

c.893A>G; p.Q298R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.243T>A; p.F81L;

large_intestine; rectumcarcinoma; adenocarcinoma

c.383A>G; p.K128R;

large_intestine; rectumcarcinoma; adenocarcinoma

c.1034T>C; p.L345P;

large_intestine; rectumcarcinoma; adenocarcinoma

c.1194A>G; p.T398T;

large_intestine; rectumcarcinoma; adenocarcinoma

c.76A>G; p.T26A;

large_intestine; rectumcarcinoma; adenocarcinoma

c.117A>G; p.A39A;

large_intestine; rectumcarcinoma; adenocarcinoma

c.77C>T; p.T26I;

large_intestine; rectumcarcinoma; adenocarcinoma

c.635-1G>A; p.?; 10:89707589-89707589

cervixcarcinoma; squamous_cell_carcinoma

c.733C>T; p.Q245*; 10:89707688-89707688

urinary_tract; bladdercarcinoma

c.657G>T; p.Q219H;

large_intestine; coloncarcinoma; adenocarcinoma

c.814C>T; p.H272Y; 10:89710643-89710643

large_intestine; coloncarcinoma; adenocarcinoma

c.1035G>A; p.L345L;

large_intestine; coloncarcinoma; adenocarcinoma

c.48T>C; p.Y16Y;

large_intestine; coloncarcinoma; adenocarcinoma

c.1031A>G; p.K344R; 10:89715028-89715028

large_intestine; coloncarcinoma; adenocarcinoma

c.825A>G; p.V275V;

large_intestine; coloncarcinoma; adenocarcinoma

c.1190A>G; p.H397R;

large_intestine; coloncarcinoma; adenocarcinoma

c.700C>T; p.R234W; 10:89707655-89707655

large_intestine; coloncarcinoma; adenocarcinoma

c.370T>C; p.C124R;

large_intestine; coloncarcinoma; adenocarcinoma

c.374A>G; p.K125R;

large_intestine; coloncarcinoma; adenocarcinoma

c.384G>A; p.K128K;

large_intestine; coloncarcinoma; adenocarcinoma

c.491A>G; p.K164R;

large_intestine; coloncarcinoma; adenocarcinoma

c.1025A>G; p.K342R;

large_intestine; coloncarcinoma; adenocarcinoma

c.117A>G; p.A39A;

large_intestine; coloncarcinoma; adenocarcinoma

c.133G>A; p.V45I;

large_intestine; coloncarcinoma; adenocarcinoma

c.383A>G; p.K128R;

large_intestine; coloncarcinoma; adenocarcinoma

c.240A>G; p.K80K;

large_intestine; coloncarcinoma; adenocarcinoma

c.310delT; p.C105fs*8;

large_intestine; coloncarcinoma; adenocarcinoma

c.381A>G; p.G127G;

large_intestine; coloncarcinoma; adenocarcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

large_intestine; coloncarcinoma; adenocarcinoma

c.378T>C; p.A126A;

large_intestine; caecumcarcinoma; adenocarcinoma

c.468G>A; p.G156G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.217G>A; p.E73K;

large_intestine; coloncarcinoma; adenocarcinoma

c.297A>G; p.E99E;

large_intestine; coloncarcinoma; adenocarcinoma

c.400A>G; p.M134V;

large_intestine; coloncarcinoma; adenocarcinoma

c.530A>T; p.Y177F;

large_intestine; coloncarcinoma; adenocarcinoma

c.1004G>A; p.R335Q;

large_intestine; coloncarcinoma; adenocarcinoma

c.764T>C; p.V255A; 10:89707719-89707719

large_intestine; coloncarcinoma; adenocarcinoma

c.449A>G; p.E150G; 10:89682945-89682945

large_intestine; coloncarcinoma; adenocarcinoma

c.19G>T; p.E7*; 10:89614225-89614225

large_intestine; coloncarcinoma; adenocarcinoma

c.690A>G; p.G230G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

large_intestine; caecumcarcinoma; adenocarcinoma

c.491A>G; p.K164R;

large_intestine; caecumcarcinoma; adenocarcinoma

c.635-1G>A; p.?; 10:89707589-89707589

large_intestine; caecumcarcinoma; adenocarcinoma

c.802-1G>T; p.?;

large_intestine; coloncarcinoma; adenocarcinoma

c.813T>C; p.F271F;

large_intestine; coloncarcinoma; adenocarcinoma

c.17A>G; p.K6R; 10:89614223-89614223

large_intestine; coloncarcinoma; adenocarcinoma

c.43A>G; p.R15G;

large_intestine; caecumcarcinoma; adenocarcinoma

c.161T>A; p.V54E;

large_intestine; caecumcarcinoma; adenocarcinoma

c.465T>C; p.Y155Y;

large_intestine; caecumcarcinoma; adenocarcinoma

c.830C>T; p.T277I; 10:89710659-89710659

large_intestine; caecumcarcinoma; adenocarcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

large_intestine; caecumcarcinoma; adenocarcinoma

c.531T>C; p.Y177Y;

large_intestine; coloncarcinoma; adenocarcinoma

c.1014T>A; p.S338S;

large_intestine; coloncarcinoma; adenocarcinoma

c.1042A>G; p.T348A;

large_intestine; coloncarcinoma; adenocarcinoma

c.1124A>G; p.D375G;

large_intestine; coloncarcinoma; adenocarcinoma

c.478A>G; p.T160A;

large_intestine; coloncarcinoma; adenocarcinoma

c.1042A>G; p.T348A;

large_intestine; coloncarcinoma; adenocarcinoma

c.382A>G; p.K128E;

large_intestine; caecumcarcinoma; adenocarcinoma

c.347A>G; p.D116G; 10:89682843-89682843

large_intestine; caecumcarcinoma; adenocarcinoma

c.407G>A; p.C136Y; 10:89682903-89682903

large_intestine; rectumcarcinoma; adenocarcinoma

c.402G>A; p.M134I;

large_intestine; rectumcarcinoma; adenocarcinoma

c.333G>A; p.W111*; 10:89682829-89682829

prostatecarcinoma; adenocarcinoma

c.739T>C; p.L247L;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.732T>C; p.P244P;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; acute_lymphoblastic_T_cell_leukaemia

c.795delA; p.K267fs*9; 10:89707750-89707750

ovarycarcinoma; clear_cell_carcinoma

c.425delG; p.G143fs*4; 10:89682921-89682921

ovarycarcinoma; clear_cell_carcinoma

c.277C>T; p.H93Y; 10:89682773-89682773

central_nervous_system; brainglioma

c.79T>A; p.Y27N; 10:89614285-89614285

central_nervous_system; brainglioma

c.107G>A; p.G36E; 10:89643789-89643789

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.210-39A>G; p.?; 10:89680744-89680744

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.1026+1G>T; p.?; 10:89710856-89710856

central_nervous_system; brainglioma

c.1026+1G>T; p.?; 10:89710856-89710856

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.741_742insA; p.P248fs*5; 10:89707696-89707697

central_nervous_system; brainglioma

c.741_742insA; p.P248fs*5; 10:89707696-89707697

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.723_724insTT; p.E242fs*15; 10:89707678-89707679

central_nervous_system; brainglioma

c.723_724insTT; p.E242fs*15; 10:89707678-89707679

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.371G>C; p.C124S; 10:89682867-89682867

central_nervous_system; brainglioma; astrocytoma_Grade_III

c.404_409delTATGTG; p.I135_A137>T; 10:89682900-89682905

central_nervous_system; brainglioma

c.723_724insTT; p.E242fs*15; 10:89707678-89707679

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.160_208del49; p.V54fs*29; 10:89643842-89675293

central_nervous_system; brainglioma; astrocytoma_Grade_IV

c.387_388insCGCC; p.G129fs*51; 10:89682883-89682884

haematopoietic_and_lymphoid_tissuehaematopoietic_neoplasm; acute_myeloid_leukaemia

c.1026+1G>T; p.?; 10:89710856-89710856

central_nervous_system; brainglioma

c.?_?ins2; p.E242fs*15;

central_nervous_system; brainglioma

c.723_724insTT; p.E242fs*15; 10:89707678-89707679

central_nervous_system; brainglioma

c.723_724insTT; p.E242fs*15; 10:89707678-89707679

central_nervous_system; brainglioma

c.209+1G>T; p.?; 10:89675295-89675295

central_nervous_system; brainglioma

c.741_742insA; p.P248fs*5; 10:89707696-89707697

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; hairy_cell_leukaemia

c.228T>G; p.Y76*; 10:89680801-89680801

skinmalignant_melanoma

c.70G>T; p.D24Y; 10:89614276-89614276

urinary_tract; bladdercarcinoma; transitional_cell_carcinoma

c.487A>T; p.K163*;

prostatecarcinoma

c.968_969insA; p.N323fs*2; 10:89710797-89710798

prostatecarcinoma

c.253+1G>T; p.?; 10:89680827-89680827

prostatecarcinoma

c.955_958delACTT; p.T319fs*1; 10:89710784-89710787

prostatecarcinoma

c.638C>G; p.P213R;

prostatecarcinoma

c.1_1212del1212; p.0?;

NSmalignant_melanoma

c.520T>G; p.Y174D; 10:89701882-89701882

skinmalignant_melanoma

c.112C>T; p.P38S; 10:89643794-89643794

NSmalignant_melanoma

c.112C>T; p.P38S; 10:89643794-89643794

skinmalignant_melanoma

c.677C>T; p.S226F;

skin; mucosalmalignant_melanoma

c.323T>G; p.L108R; 10:89682819-89682819

breastcarcinoma

c.323T>G; p.L108R; 10:89682819-89682819

breastcarcinoma; luminal_NS_carcinoma

c.105G>T; p.M35I;

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.635-27_635-7del21; p.?;

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.633C>A; p.C211*; 10:89701995-89701995

kidneycarcinoma; clear_cell_renal_cell_carcinoma

c.407G>T; p.C136F; 10:89682903-89682903

meningesmeningioma; anaplastic

c.382A>T; p.K128*;

stomachadenocarcinoma

c.795_796insA; p.D268fs*30;

stomachadenocarcinoma

c.39A>C; p.K13N;

stomachadenocarcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

stomachadenocarcinoma

c.795delA; p.K267fs*9; 10:89707750-89707750

stomachadenocarcinoma

c.963delA; p.T321fs*23; 10:89710792-89710792

stomachadenocarcinoma

c.48T>G; p.Y16*;

stomachadenocarcinoma

c.805A>T; p.K269*;

stomachadenocarcinoma

c.413_492+1191>A; p.?;

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; Burkitt_lymphoma

c.697C>T; p.R233*; 10:89707652-89707652

haematopoietic_and_lymphoid_tissuelymphoid_neoplasm; Burkitt_lymphoma


')