Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

554210

Name

MIR429

Synonym

MIRN429|hsa-mir-429;microRNA 429;MIR429;microRNA 429

Definition

-

Position

1p36.33

Gene Type

miscRNA

External Links

Links to Entrez Gene

554210

Links to all GeneRIF Items

554210

Links to iHOP

554210

Sequence Information

Nucleotide Sequence

>554210 : length: 22
taatactgtctggtaaaaccgt

Protein Sequence

>554210 : length: 3
N/A



')