Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

407046

Name

MIR9-1

Synonym

MIRN9-1|hsa-mir-9-1|miRNA9-1;microRNA 9-1;MIR9-1;microRNA 9-1

Definition

-

Position

1q22

Gene Type

miscRNA

External Links

Links to Entrez Gene

407046

Links to all GeneRIF Items

407046

Links to iHOP

407046

Sequence Information

Nucleotide Sequence

>407046 : length: 23
tctttggttatctagctgtatga

Protein Sequence

>407046 : length: 3
N/A



')