Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

407042

Name

MIR34C

Synonym

MIRN34C|miRNA34C;microRNA 34c;MIR34C;microRNA 34c

Definition

-

Position

11q23.1

Gene Type

miscRNA

External Links

Links to Entrez Gene

407042

Links to all GeneRIF Items

407042

Links to iHOP

407042

Sequence Information

Nucleotide Sequence

>407042 : length: 23
aggcagtgtagttagctgattgc

Protein Sequence

>407042 : length: 3
N/A



')