Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

407040

Name

MIR34A

Synonym

MIRN34A|miRNA34A|mir-34;microRNA 34a;MIR34A;microRNA 34a

Definition

-

Position

1p36.22|1p36.22

Gene Type

miscRNA

External Links

Links to Entrez Gene

407040

Links to all GeneRIF Items

407040

Links to iHOP

407040

Sequence Information

Nucleotide Sequence

>407040 : length: 22
tggcagtgtcttagctggttgt

Protein Sequence

>407040 : length: 3
N/A



')