Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

407039

Name

MIR33A

Synonym

MIR33|MIRN33|MIRN33A|hsa-mir-33|hsa-mir-33a|miR-33|miRNA33A;microRNA 33a;MIR33A;microRNA 33a

Definition

-

Position

22q13.2

Gene Type

miscRNA

External Links

Links to Entrez Gene

407039

Links to all GeneRIF Items

407039

Links to iHOP

407039

Sequence Information

Nucleotide Sequence

>407039 : length: 21
gtgcattgtagttgcattgca

Protein Sequence

>407039 : length: 3
N/A



')