Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

407010

Name

MIR23A

Synonym

MIRN23A|hsa-mir-23a|miRNA23A;microRNA 23a;MIR23A;microRNA 23a

Definition

-

Position

19p13.13

Gene Type

miscRNA

External Links

Links to Entrez Gene

407010

Links to all GeneRIF Items

407010

Links to iHOP

407010

Sequence Information

Nucleotide Sequence

>407010 : length: 22
ggggttcctggggatgggattt

Protein Sequence

>407010 : length: 3
N/A



')