Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

407007

Name

MIR222

Synonym

MIRN222|miRNA222|mir-222;microRNA 222;MIR222;microRNA 222

Definition

-

Position

Xp11.3

Gene Type

miscRNA

External Links

Links to Entrez Gene

407007

Links to all GeneRIF Items

407007

Links to iHOP

407007

Sequence Information

Nucleotide Sequence

>407007 : length: 22
ctcagtagccagtgtagatcct

Protein Sequence

>407007 : length: 3
N/A



')