Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

407006

Name

MIR221

Synonym

MIRN221|miRNA221|mir-221;microRNA 221;MIR221;microRNA 221

Definition

-

Position

Xp11.3

Gene Type

miscRNA

External Links

Links to Entrez Gene

407006

Links to all GeneRIF Items

407006

Links to iHOP

407006

Sequence Information

Nucleotide Sequence

>407006 : length: 22
acctggcatacaatgtagattt

Protein Sequence

>407006 : length: 3
N/A



')