Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406991

Name

MIR21

Synonym

MIRN21|hsa-mir-21|miR-21|miRNA21;microRNA 21;MIR21;microRNA 21

Definition

-

Position

17q23.1

Gene Type

miscRNA

External Links

Links to Entrez Gene

406991

Links to all GeneRIF Items

406991

Links to iHOP

406991

Sequence Information

Nucleotide Sequence

>406991 : length: 22
tagcttatcagactgatgttga

Protein Sequence

>406991 : length: 3
N/A



')