Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406988

Name

MIR205

Synonym

MIRN205;microRNA 205;MIR205;microRNA 205

Definition

-

Position

1q32.2

Gene Type

miscRNA

External Links

Links to Entrez Gene

406988

Links to all GeneRIF Items

406988

Links to iHOP

406988

Sequence Information

Nucleotide Sequence

>406988 : length: 22
tccttcattccaccggagtctg

Protein Sequence

>406988 : length: 3
N/A



')