Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406985

Name

MIR200C

Synonym

MIRN200C;microRNA 200c;MIR200C;microRNA 200c

Definition

-

Position

12p13.31

Gene Type

miscRNA

External Links

Links to Entrez Gene

406985

Links to all GeneRIF Items

406985

Links to iHOP

406985

Sequence Information

Nucleotide Sequence

>406985 : length: 22
cgtcttacccagcagtgtttgg

Protein Sequence

>406985 : length: 3
N/A



')