Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406984

Name

MIR200B

Synonym

MIRN200B;microRNA 200b;MIR200B;microRNA 200b

Definition

-

Position

1p36.33

Gene Type

miscRNA

External Links

Links to Entrez Gene

406984

Links to all GeneRIF Items

406984

Links to iHOP

406984

Sequence Information

Nucleotide Sequence

>406984 : length: 22
catcttactgggcagcattgga

Protein Sequence

>406984 : length: 3
N/A



')