Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406983

Name

MIR200A

Synonym

MIRN200A;microRNA 200a;MIR200A;microRNA 200a

Definition

-

Position

1p36.33

Gene Type

miscRNA

External Links

Links to Entrez Gene

406983

Links to all GeneRIF Items

406983

Links to iHOP

406983

Sequence Information

Nucleotide Sequence

>406983 : length: 22
catcttaccggacagtgctgga

Protein Sequence

>406983 : length: 3
N/A



')