Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406969

Name

MIR194-1

Synonym

MIRN194-1;microRNA 194-1;MIR194-1;microRNA 194-1

Definition

-

Position

1q41

Gene Type

miscRNA

External Links

Links to Entrez Gene

406969

Links to all GeneRIF Items

406969

Links to iHOP

406969

Sequence Information

Nucleotide Sequence

>406969 : length: 22
tgtaacagcaactccatgtgga

Protein Sequence

>406969 : length: 3
N/A



')