Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406968

Name

MIR193A

Synonym

MIRN193|MIRN193A;microRNA 193a;MIR193A;microRNA 193a

Definition

-

Position

17q11.2

Gene Type

miscRNA

External Links

Links to Entrez Gene

406968

Links to all GeneRIF Items

406968

Links to iHOP

406968

Sequence Information

Nucleotide Sequence

>406968 : length: 22
tgggtctttgcgggcgagatga

Protein Sequence

>406968 : length: 3
N/A



')