Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406941

Name

MIR149

Synonym

MIRN149;microRNA 149;MIR149;microRNA 149

Definition

-

Position

2q37.3

Gene Type

miscRNA

External Links

Links to Entrez Gene

406941

Links to all GeneRIF Items

406941

Links to iHOP

406941

Sequence Information

Nucleotide Sequence

>406941 : length: 23
tctggctccgtgtcttcactccc

Protein Sequence

>406941 : length: 3
N/A



')