Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406928

Name

MIR137

Synonym

MIRN137;microRNA 137;MIR137;microRNA 137

Definition

-

Position

1p21.3

Gene Type

miscRNA

External Links

Links to Entrez Gene

406928

Links to all GeneRIF Items

406928

Links to iHOP

406928

Sequence Information

Nucleotide Sequence

>406928 : length: 23
ttattgcttaagaatacgcgtag

Protein Sequence

>406928 : length: 3
N/A



')