Epithelial-Mesenchymal Transition gene database (dbEMT) Home
dbEMT
Pediatric cancer database
General information | Literature | Expression | Regulation | Variant | Interaction

Basic Information

Gene ID

406907

Name

MIR124-1

Synonym

MIR124A|MIR124A1|MIRN124-1|MIRN124A1;microRNA 124-1;MIR124-1;microRNA 124-1

Definition

-

Position

8p23.1

Gene Type

miscRNA

External Links

Links to Entrez Gene

406907

Links to all GeneRIF Items

406907

Links to iHOP

406907

Sequence Information

Nucleotide Sequence

>406907 : length: 22
cgtgttcacagcggaccttgat

Protein Sequence

>406907 : length: 3
N/A



')